Tongji2018 (Talk | contribs) |
|||
Line 32: | Line 32: | ||
<p style="text-align:center"><img src="https://static.igem.org/mediawiki/2018/a/a1/T--Tongji_China--design_drylab_filter--.png" width="80%"></p> | <p style="text-align:center"><img src="https://static.igem.org/mediawiki/2018/a/a1/T--Tongji_China--design_drylab_filter--.png" width="80%"></p> | ||
<a name="phase2" style="text-decoration:none;"> </a><br><br><br><br> | <a name="phase2" style="text-decoration:none;"> </a><br><br><br><br> | ||
− | <div class="littletitle">PHASE 2. Plasmid | + | <div class="littletitle">PHASE 2. Plasmid construction</div><br> |
− | We want to | + | We want to create a new method to deliver the neoantigens into mammalian immune cells. We choose Type III secretion system (T3SS), which is a amazing protein delivery tool. To make use of T3SS, we first need to insert our antigen sequences into T3SS plasmid. |
<br><br> | <br><br> | ||
− | <font color="#EEC778" face=charcoal size="4"><I><b># de novo | + | <font color="#EEC778" face=charcoal size="4"><I><b># de novo neoantigen gene synthesis</b></I></font><br> |
− | Because | + | Because the antigen sequence is quite short, we cannot choose the common way of synthesizing double strand. So we synthesize the 5’-3’single strand and the 3’-5’single strand with restriction site on both side, then take the method of annealing to pair two single strands into a double strand.<br><br> |
<div style="text-align:center"><table> | <div style="text-align:center"><table> | ||
<tr> | <tr> | ||
Line 121: | Line 121: | ||
<br><br> | <br><br> | ||
− | <font color="#EEC778" face=charcoal size="4"><b><I># T3SS & neo-antigen plasmid | + | <font color="#EEC778" face=charcoal size="4"><b><I># T3SS & neo-antigen plasmid construction<br></I></b></font> |
− | We use the attenuated P. aeruginosa strain | + | We use the attenuated P. aeruginosa strain PAKJ△9, which 7 virulence-related genes (exoS/T/Y, ndk, xcpQ, lasI, rhlI) and one T3S suppressor gene (popN) are knocked out. The μA gene is mutated and makes this strain a auxotrophic strain that cannot live without D-Glutamate. |
<br>Because of forming T3SS, they are employed as the protein delivery vectors. | <br>Because of forming T3SS, they are employed as the protein delivery vectors. | ||
<br>Antigens of interest were cloned and expressed on an Escherichia-Pseudomonas shuttle expression plasmid, which encodes the T3S effector ExoS promoter with N-terminal ExoS1–54 signal sequence, followed by a FLAG tag and a multiple cloning site (MCS). Also on the vector, an intact spcS gene encoding the chaperone for the ExoS. | <br>Antigens of interest were cloned and expressed on an Escherichia-Pseudomonas shuttle expression plasmid, which encodes the T3S effector ExoS promoter with N-terminal ExoS1–54 signal sequence, followed by a FLAG tag and a multiple cloning site (MCS). Also on the vector, an intact spcS gene encoding the chaperone for the ExoS. |
Revision as of 14:06, 16 October 2018
Project
Design
Here you can read how we establish, organize and execute our project of OCANDY:
PHASE 1. Dry lab filter
We use bioinformatic methods to filter our item antigens from SNVs (single nucleotide variations) which occur duing the development of cancer cells.
For some SNVs will produce proteins that are not found in normal tissues and normal cells. These proteins are likely to activate and attract immune system to attack the tumor cells.
According to making peptide windows and testing the MHC-I affinity, we can analyse the immunogenicity of our item antigens which are related with colon cancer, then we remould the plasmid of Pseudomonas aeruginosa, adding the gene of interest--antigen gene behind the signing peptide gene.
If you want to know more information about dry lab filter, please go to our dry lab_programme.
PHASE 2. Plasmid construction
We want to create a new method to deliver the neoantigens into mammalian immune cells. We choose Type III secretion system (T3SS), which is a amazing protein delivery tool. To make use of T3SS, we first need to insert our antigen sequences into T3SS plasmid.
# de novo neoantigen gene synthesis
Because the antigen sequence is quite short, we cannot choose the common way of synthesizing double strand. So we synthesize the 5’-3’single strand and the 3’-5’single strand with restriction site on both side, then take the method of annealing to pair two single strands into a double strand.
Part name | Antigen | Sequence |
BBa_K2730001 | NY-ESO-A | atgtcgttgttgatgctgatcacccagtgcccgttgtga |
BBa_K2730002 | NY-ESO-B | atgcagttgtcgttgttgatgctgatcacctga |
BBa_K2730003 | 0201 | atgttgcacttgtagggctcgtagccgccggcgtga |
BBa_K2730004 | 0301A | atgcacttgtagggctcgtagccgccggcgcggtga |
BBa_K2730005 | 0301B | atggcgatctcgacccgggacccgttgtcgaagtga |
BBa_K2730006 | 0301C | atgaagttgttgaagcggcaggcggaaggcaagtga |
Table1.our antigen sequences
# T3SS & neo-antigen plasmid construction
We use the attenuated P. aeruginosa strain PAKJ△9, which 7 virulence-related genes (exoS/T/Y, ndk, xcpQ, lasI, rhlI) and one T3S suppressor gene (popN) are knocked out. The μA gene is mutated and makes this strain a auxotrophic strain that cannot live without D-Glutamate.
Because of forming T3SS, they are employed as the protein delivery vectors.
Antigens of interest were cloned and expressed on an Escherichia-Pseudomonas shuttle expression plasmid, which encodes the T3S effector ExoS promoter with N-terminal ExoS1–54 signal sequence, followed by a FLAG tag and a multiple cloning site (MCS). Also on the vector, an intact spcS gene encoding the chaperone for the ExoS.
Antigens of interest can be fused in-frame utilizing the MCS and the fusion proteins can be detected by following the FLAG tag. Under the guidance of ExoS1–54 secretion signal and the assistance of ExoS chaperone (SpcS), the target peptides can be efficiently injected into mammalian cells via the T3SS.
PHASE 3. Testing in vitro and in vivo
To find our filtered neo-antigens whether are expressed and have strong immunogenicity, we have a series of experiments and build some modeling, you can see them in Lab.
We do western blot to confirm our antigens that can be secreted after inducing by the low Ca2+ environment or the host cells' attachment.
We use immunocytochemistry method to see the antigens are delivered into the host cells successfully
We use immunohistochemistry method with the help of mice to detect the immune reaction so that our project design can be run to the cancer therapy on the aspect of immunotherapy.
PHASE 4. Improvement
# Mouse model
Our wet lab experiment is not completed, we just do the earlier stage work to show our method take effect, but we also need to verify whether it’s better by oral intake.
# Individual therapy
Now our dry lab in project is just catching many cancer people’s samples to find some common antigens as neo-antigen. This method will have some effects but as we all know, different person’s cancer cells have various mutants, if we want to take them as neo-antigens to therapy, we need to proceed from the individual.
Maybe we can expand and enrich our data from cancer people and optimize our algorithm to find more effective neo-antigens.
Before we get more patients data, we build a modeling to help predict which mutantional site can be the best one for peptide making as a high immunogenic neo-antigen for the certain patient. We think our method will contribute to the individual therapy.
# Combination therapy
Neoantigen as an immunotherapy can also take some side effects, if the immunogenicity is very strong, and the targeting of cancer is not very powerful, maybe it will hurt normal tissue. So we can match our method with other medicine of cancer therapy, on the one hand, it can reduce the new mutants to emerge, on the other hand it will help us to alleviate the bad influence of our method.
We need to test which medicine can be a good partner.
Return to the Project Overview