Difference between revisions of "Team:Tongji China/Demonstrate"

Plasmid Construction

Achievements

Successfully conduct 2 plasmids containing positive control antigen DNA.
Successfully conduct 4 plasmids containing antigen DNA according to our filteration.

Introduction

In order to let the P. aeruginosa inject the antigens into the antigen presenting cells (APCs), we first need to add the antigens into the T3SS plasmid. Escherichia-Pseudomonas shuttle expression plasmid pExoS54F (shows in Figure 1), which encodes the T3SS effector ExoS promoter with N-terminal ExoS1–54 signal sequence, followed by a FLAG tag and a multiple cloning site (MCS). The pExoS54F plasmid contains two promoter region which can be activated simultaneously by ExsA binding to their common promoter region. PexoS is the promoter region which originally belongs to the toxin gene ExoS and the wild type P. aeruginosa inject the toxin ExoS into the host cell through the T3SS. The P. aeruginosa strain we use has knocked out the ExoS gene so we utilize its promoter and its N-terminal ExoS1–54 signal sequence which act as a T3SS secretion signal to let the T3SS secret proteins of interest. SpcS is a kind of T3SS chaperone and help the proteins of interest to enter the T3SS secretion channel.

The proteins contained in the pExoS54F are actually not all the proteins that function in the T3SS protein delivery. There are approximately 40 proteins that regulate the secretion of T3SS effector proteins and many of them are encoded in the P. aeruginosa genome. The protein ExsE, ExsC, ExsD and ExsA are four cytoplasmic proteins (shows in the Figure 2) that control the coupling of transcription and secretion. ExsA is a DNA-binding protein required for transcriptional activation of the entire T3SS. The second regulatory protein, ExsD, functions as anti-activator by directly binding to ExsA. ExsC functions as an anti-anti-activator by directly binding to and inhibiting ExsD. ExsE functions as a direct inhibitor of ExsC and provide an initiating signal for the whole process. Figure 2 shows the situation when the T3SS secretion is inhibit because the direct activator ExsA is inhibited by the binding ExsD.

Overview

1.Sequence Synthesis
2.Plasmid Restricted Digestion
3.Ligation & Transformation

Results

1.Sequence Synthesis
As we successfully filter many antigens which may active the immune system and guide the T cells to target to the cancer, we choose 4 of them and two positive control antigens – NY-ESO-A and NY-ESO-B. NY-ESO is widely known as a germ cell protein that is often expressed by tumor cells but not normal somatic cells. The frequent finding of humoral and cellular immune responses against this antigen in cancer patients with NY-ESO-expressing tumors makes it one of the most immunogenic human tumor antigens known. Table 1 shows the antigens sequences.

Part name	Antigen	Sequence
BBa_K2730001	NY-ESO-A	atgtcgttgttgatgctgatcacccagtgcccgttgtga
BBa_K2730002	NY-ESO-B	atgcagttgtcgttgttgatgctgatcacctga
BBa_K2730003	0201	atgttgcacttgtagggctcgtagccgccggcgtga
BBa_K2730004	0301A	atgcacttgtagggctcgtagccgccggcgcggtga
BBa_K2730005	0301B	atggcgatctcgacccgggacccgttgtcgaagtga
BBa_K2730006	0301C	atgaagttgttgaagcggcaggcggaaggcaagtga

Because the antigen sequence is quite short, we cannot choose the common way of synthesizing double strand. So we synthesize the 5’-3’single strand and the 3’-5’single strand with restriction site on both side, then take the method of annealing (see in the protocol.) to pair two single strands into a double strand (Figure 3). Table 2 shows all the single strands we synthesized.