Difference between revisions of "Team:Tongji China/Design"

      

Here you can read how we establish, organize and execute our project of OCANDY:



PHASE 1. Dry lab filter
We use bioinformatic methods to filter our item antigens from SNVs (single nucleotide variations) which occur duing the development of cancer cell.
For some SNVs will produce proteins that are not found in normal tissues and normal cells. These proteins are likely to activate the immune system and attract immune system to attack the tumor cell.
After analysing the immunogenicity of our item antigens which are related with colon cancer, we remould the plasmid of Pseudomonas aeruginosa, adding the gene of interest--antigen gene behind the signing peptide gene.

PHASE 2. Plasmid remoulding
We want to have a new try to make protein delivery effectively into mammalian cell. We chose T3SS as a tool to deliver. Now we need to assemble T3SS and the antigens of our interest together.

# de novo neo-antigen gene synthesis
Because our antigens are very short, we attach P1 as the forward primer and use the antigen sequence as the reverse primer to synthesize so that they can be part of the plasmid of T3SS.

Part name	Antigen	Sequence
BBa_K2730001	NY-ESO-A	atgtcgttgttgatgctgatcacccagtgcccgttgtga
BBa_K2730002	NY-ESO-B	atgcagttgtcgttgttgatgctgatcacctga
BBa_K2730003	EX0201	atgttgcacttgtagggctcgtagccgccggcgtga
BBa_K2730004	EX0301A	atgcacttgtagggctcgtagccgccggcgcggtga
BBa_K2730005	EX0301B	atggcgatctcgacccgggacccgttgtcgaagtga
BBa_K2730006	EX0301C	atgaagttgttgaagcggcaggcggaaggcaagtga

# T3SS & neo-antigen plasmid creation
We use the attenuated P. aeruginosa strain delta 8, deleted of 7 virulence-related genes (exoS/T/Y, ndk, xcpQ, lasI, rhlI) and one T3S suppressor gene (popN), and delta 9, adding the function of nutritional deficiencies.
Because of forming T3SS, they are employed as the protein delivery vectors.
Antigens of interest were cloned and expressed on an Escherichia-Pseudomonas shuttle expression plasmid, which encodes the T3S effector ExoS promoter with N-terminal ExoS1–54 signal sequence, followed by a FLAG tag and a multiple cloning site (MCS). Also on the vector, an intact spcS gene encoding the chaperone for the ExoS.
Antigens of interest can be fused in-frame utilizing the MCS and the fusion proteins can be detected by following the FLAG tag. Under the guidance of ExoS1–54 secretion signal and the assistance of ExoS chaperone (SpcS), the target peptides can be efficiently injected into mammalian cells via the T3SS.




PHASE 3. Testing in vitro and in vivo

To find our filtered neo-antigens whether are expressed and have strong immunogenicity, we have a series of experiments and build some modeling, you can see them in Lab.
We do western blot to confirm our antigens that can be secreted after inducing by the low Ca2+ environment or the host cells' attachment.
We use immunofluorescence to see the antigens are delivered into the host cells successfully.
We do ELISA with the help of mice to detect the immune reaction so that our project design can be run to the cancer therapy on the aspect of immunotherapy.


PHASE 4. Improvement

# Mouse model
Our wet lab experiment is not completed, we just do the earlier stage work to show our method take effect, but we also need to verify whether it’s better by oral intake.

# Individual therapy
Now our dry lab in project is just catching many cancer people’s samples to find some common antigens as neo-antigen. This method will have some effects but as we all know, different person’s cancer cells have various mutants, if we want to take them as neo-antigens to therapy, we need to proceed from the individual.
Maybe we can expand and enrich our data from cancer people and optimize our algorithm to find more effective neo-antigens.

# Combination therapy
Neoantigen as an immunotherapy can also take some side effects, if the immunogenicity is very strong, and the targeting of cancer is not very powerful, maybe it will hurt normal tissue. So we can match our method with other medicine of cancer therapy, on the one hand, it can reduce the new mutants to emerge, on the other hand it will help us to alleviate the bad influence of our method.
We need to test which medicine can be a good partner.


Return to the Project Overview