Team:Tufts/Design
Design
The principle in the design was to have the left segment of the toehold contain a sequence complementary to miRNAs known to be emitted during disease processes. The remainder of the toehold was based on a scaffold in Alexander Green et al 2014 paper. The central part of the toehold contains a palindromic repeat that anneals together, forming the main hairpin area. The top of the hairpin contains a ribosome binding site sequence. The bottom right side of the toehold contains a start codon and a linker sequence, which extends into the suppressed gene, in this case Cas13a. Upon binding of the complementary miRNA, the toehold collapses, allowing translation to begin. When Cas13a has been translated and becomes a functional protein, it requires a guide RNA before its nonspecific RNAse activity can begin. The guide RNA is found in the solution of the system. After the guide RNA is found, the Cas13a cuts indiscriminately. An RNAse detector kit is used in this phase, which contains a fluorescent probe along with a quencher. When the RNA is cut, a fluorescent signal is produced.
Components of a toehold switch
- Switch that activates collapse
- Ribosome binding site
- Start codon
Toehold scaffold below taken from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4265554/
5’GGG|_______15nt_______|_b*_|_a*_|tat|ccctgcatacagaaacagaggagatatgca|atg|ata|_a_|_b_|aacctggcggcagcgcaaag|____Gene___|3’
b*=reverse complement of b, 15nt region is reverse complement of target microRNA sequence
Our toehold was based on a similar design
5’GGG|CATATTGGCACTGCA|CAT|GAT|tat|ccctgcatacagaaacagaggagatatgca|atg|ata|ATC|ATG|aacctggcggcagcgcaaag|____Cas13a___|3’
In this case, the 15 nucleotide sequence is complementary to a miRNA sequence linked to breast cancer, hsa-miR-100-5p
The forward primer sequence was GGGCACAAGTTCGGATCTACGG, while the reverse primer sequence, complementary to that of Cas13a based on the completed toehold switch sequence, was ctttgcgctgccgcca. These sequences are all in DNA nucleotides as in the original design, oligonucleotides were intended to be converted into RNA by means of a kit