Team:Tongji China/Demonstrate
Wet Lab
Experiment
Plasmid Construction
Achievements
Successfully conduct 2 plasmids containing positive control antigen DNA.Successfully conduct 4 plasmids containing antigen DNA according to our filteration.
Introduction
In order to let the P. aeruginosa inject the antigens into the antigen presenting cells (APCs), we first need to add the antigens into the T3SS plasmid. Escherichia-Pseudomonas shuttle expression plasmid pExoS54F (shows in Figure 1), which encodes the T3SS effector ExoS promoter with N-terminal ExoS1–54 signal sequence, followed by a FLAG tag and a multiple cloning site (MCS). The pExoS54F plasmid contains two promoter region which can be activated simultaneously by ExsA binding to their common promoter region. PexoS is the promoter region which originally belongs to the toxin gene ExoS and the wild type P. aeruginosa inject the toxin ExoS into the host cell through the T3SS. The P. aeruginosa strain we use has knocked out the ExoS gene so we utilize its promoter and its N-terminal ExoS1–54 signal sequence which act as a T3SS secretion signal to let the T3SS secret proteins of interest. SpcS is a kind of T3SS chaperone and help the proteins of interest to enter the T3SS secretion channel.
Figure 1 | Escherichia-Pseudomonas shuttle expression plasmid pExoS54F
The proteins contained in the pExoS54F are actually not all the proteins that function in the T3SS protein delivery. There are approximately 40 proteins that regulate the secretion of T3SS effector proteins and many of them are encoded in the P. aeruginosa genome. The protein ExsE, ExsC, ExsD and ExsA are four cytoplasmic proteins (shows in the Figure 2) that control the coupling of transcription and secretion. ExsA is a DNA-binding protein required for transcriptional activation of the entire T3SS. The second regulatory protein, ExsD, functions as anti-activator by directly binding to ExsA. ExsC functions as an anti-anti-activator by directly binding to and inhibiting ExsD. ExsE functions as a direct inhibitor of ExsC and provide an initiating signal for the whole process. Figure 2 shows the situation when the T3SS secretion is inhibit because the direct activator ExsA is inhibited by the binding ExsD.
Figure 2 | Four cytoplasmic proteins ExsE, ExsC, ExsD and ExsA control the coupling of transcription and secretion.
Overview
1.Sequence Synthesis2.Plasmid Restricted Digestion
3.Ligation & Transformation
Results
1.Sequence SynthesisAs we successfully filter many antigens which may active the immune system and guide the T cells to target to the cancer, we choose 4 of them and two positive control antigens – NY-ESO-A and NY-ESO-B. NY-ESO is widely known as a germ cell protein that is often expressed by tumor cells but not normal somatic cells. The frequent finding of humoral and cellular immune responses against this antigen in cancer patients with NY-ESO-expressing tumors makes it one of the most immunogenic human tumor antigens known. Table 1 shows the antigens sequences.
| Part name | Antigen | Sequence |
|---|---|---|
| BBa_K2730001 | NY-ESO-A | atgtcgttgttgatgctgatcacccagtgcccgttgtga |
| BBa_K2730002 | NY-ESO-B | atgcagttgtcgttgttgatgctgatcacctga |
| BBa_K2730003 | 0201 | atgttgcacttgtagggctcgtagccgccggcgtga |
| BBa_K2730004 | 0301A | atgcacttgtagggctcgtagccgccggcgcggtga |
| BBa_K2730005 | 0301B | atggcgatctcgacccgggacccgttgtcgaagtga |
| BBa_K2730006 | 0301C | atgaagttgttgaagcggcaggcggaaggcaagtga |
Table1 | our antigen sequences
Because the antigen sequence is quite short, we cannot choose the common way of synthesizing double strand. So we synthesize the 5’-3’single strand and the 3’-5’single strand with restriction site on both side, then take the method of annealing (see in the protocol.) to pair two single strands into a double strand (Figure 3). Table 2 shows all the single strands we synthesized.
| NY-ESO-A-F | ctagaATGTCGTTGTTGATGCTGATCACCCAGTGCCCGTTGTGAg |
| NY-ESO-A-R | tcgacTCATCACAACGGGCACTGGGTGATCAGCATCAACAACGACATt |
| NY-ESO-B-F | ctagaATGCAGTTGTCGTTGTTGATGCTGATCACCTGAg |
| NY-ESO-B-R | tcgacTCAGGTGATCAGCATCAACAACGACAACTGCATt |
| 0201-F | ctagaATGTTGCACTTGTAGGGCTCGTAGCCGCCGGCGTGAg |
| 0201-R | tcgacTCACGCCGGCGGCTACGAGCCCTACAAGTGCAACATt |
| 0301A-F | ctagaATGCACTTGTAGGGCTCGTAGCCGCCGGCGCGGTGAg |
| 0301A-R | tcgacTCACCGCGCCGGCGGCTACGAGCCCTACAAGTGCATt |
| 0301B-F | ctagaATGGCGATCTCGACCCGGGACCCGTTGTCGAAGTGAg |
| 0301B-R | tcgacTCACTTCGACAACGGGTCCCGGGTCGAGATCGCCATt |
| 0301C-F | ctagaATGAAGTTGTTGAAGCGGCAGGCGGAAGGCAAGTGAg |
| 0301C-R | tcgacTCACTTGCCTTCCGCCTGCCGCTTCAACAACTTCATt |
Table2 | All the single strands
Figure 3 | Annealing
2.Plasmid Restricted Digestion
We use the restriction endonuclease Xal I and Sal I to digest the pExoS54F plasmid (see in the protocol). Also the antigen sequences we synthesized have the restriction site of Xal I and Sal I. we set the single digestion control and the plasmid control to figure out whether the plasmid is digested completely. The DNA gel electrophoresis results (Figure 4) shows that the digestion is complete.
Figure 4 | DNA gel electrophoresis results for plasmid restricted digestion
3. Ligation & Transformation
We ligase the digestion product and double-stranded fragment using T4 DNA ligase and conduct the chemical transfection (see in the protocol). We conduct the colony PCR to test whether the colonies contain the right plasmid (see in the protocol). The DNA gel electrophoresis results (Figure 5) shows that some of the colonies contain the right plasmids we want.
Figure 5 | DNA gel electrophoresis results for colony PCR
Functional Analysis of T3SS system
Achievements
- We confirm that P. aeruginosa can synthesize the antigens by the induction of EGTA.
- Through infection of HeLa cells in vitro, we prove that bacteria can inject antigens into cells.
- We briefly confirm that the bacteria did not secrete proteins outside the cells while attaching cells and injecting.
- Using the mouse animal model, the T3SS system is proven to work in vivo.
Introduction
In normal low calcium environment, antigens can’t be released by bacteria.
Figure 1 | In normal environment, pore of T3SS is closed, and antigens can’t pass through.
Secretion of the antigens can be activated in two ways.
One way is to form the host cell contact. When a contact signal has been sensed by the bacteria, a rapid production and specific insertion into the translocon follows and the antigens can successfully be injected into the host cell cytosol, without wasting them into the culture supernatant. This way is called “polar translocation”.
Figure 2 | Polar Translocation
Another way is triggered with low calcium environment, such as in the presence of calcium chelator EGTA. It can trigger the bacteria to release the antigens into the culture medium without the formation of the T3SS translocon. This way works without the presence of host cells and defined as “non-polar translocation”.
Figure 3 | Polar Translocation
To analyze the antigen secretion ability of the engineered bacteria we construct, we use both the “non-polar translocation” way and the “polar translocation” way to conduct the experiment. The signature is detected by the Flag-tag which is carried in pExoS54F-NY-ESO-A, pExoS54F-NY-ESO-B, pExoS54F-0201, pExoS54F-0301A, pExoS54F-0301B, pExoS54F-0301C and pExoS54F-mCherry.
Results
RESULT 1.
All the secretion of proteins in the P. aeriginosa strain PAK-J△9 are analyzed by western blot. We use the calcium chelator EGTA to trigger the secretion of proteins. (To see the exact process of the induction, you can go to the Protocol.) Add 100% TCA to culture medium to reach a final concentration of approximately 10% which can precipitate the proteins form culture medium. But the final concentration of TCA used may vary with the molecular weight of the precipitated protein and shouldn’t be too high, otherwise other substances will be precipitated.
First, we test which TCA concentration can better precipitate proteins from culture medium and set the TCA concentration gradient of 10%, 15% to 20%. We randomly select one type of P. aeruginosa which carrying the antigen in theory to conduct the experiment.
The result is analyzed by western blot (Figure 1.1). As is shown in figure, 20% TCA concentration successfully precipitates the proteins. So we decide to use the 20% TCA concentration.
Figure 1.1 | As is shown in the figure, both 10% and 15% TCA concentration cannot precipitate the proteins from culture medium, only the 20% TCA concentration can successfully precipitate the proteins.
According to the conclusion we made in the first experiment, we conduct EGTA induction experiment to test whether the engineered P. aeruginosa we constructed can produce and secret the antigens.
We set 6 test groups and a control group. Each test group contains engineered P. aeruginosa carrying the plasmid pExoS54F-NY-ESO-A, pExoS54F-NY-ESO-B, pExoS54F-0201, pExoS54F-0301A, pExoS54F-0301B and pExoS54F-0301C. The culture medium of the control group is without the presence of EGTA and the rest of the conditions are consistent with the test groups.
The result is analyzed by western blot (Figure 1.2). Five antigens (NY-ESO-A, NY-ESO-B, 0201, 0301A and 0301C) are successfully secreted by bacteria.
Figure 1.2 | Five antigens (NY-ESO-A, NY-ESO-B, 0201, 0301A and 0301C) are successfully secreted by bacteria but no extinct signal was detected from 0301B.
There may be something wrong in our operation with pExoS54F-0301B plasmid, but we don’t have enough time to test. If we have more time, we will do this experiment again using pExoS54F-0201 plasmid as positive control to make sure the whole experiment operation is correct. At the same time, we will do colony PCR to check the pExoS54F-0301B plasmids are still in our engineered P. aeruginosa. If we can’t get successful result, we will repeat experiments from Electroporation of P. aeruginosa.
From another 5 plasmids, we can draw a conclusion that the bacteria can synthesize the antigens we want by the induction of EGTA.
RESULT 2.
We conduct an experiment to analyze whether the host cell contact can trigger the production of the antigens and whether the engineered P. aeruginosa can inject these antigens into host cell cytosol in the level of protein.
We infect the HeLa cells with the engineered P. aeruginosa respectively carrying the plasmid pExoS54F-NY-ESO-A, pExoS54F-NY-ESO-B, pExoS54F-0201, pExoS54F-0301A, pExoS54F-0301B and pExoS54F-0301C, then collect the HeLa cell lysates. We analyze the cell lysates by western blot (Figure 2).
Figure 2 |
protocol.)
We use an epifluorescence microscope to confirm the presence of intracellular antigens and observe finer structures by using confocal microscope.
We can see several cells are injected antigens by T3SS system. But the efficiency is not high, which is related to the relative amount of cells and bacteria. And what caught our attention is that we can find green antigens in the group of pExoS54F-0301B plasmid, which support this plasmid is worked. So, we can confirm that, P. aeruginosa can inject antigens into cells in vitro.
We collect the culture supernatant of bacterially infected cells and use the TCA-acetone precipitation to precipitate the secreted proteins which may be contained in the culture supernatant. To prove the experimental operation is correct, we set a positive control of cell lysates (These cells are infected by P. aeruginosa carrying pExoS54F-mCherry). Then we analyze the sediment by western blot to figure out the existence of the secreted proteins (Figure 3). As is shown in the figure, all of the culture supernatant of bacterially infected cells do not contain the proteins, which further prove that our system is safe enough.
We use an epifluorescence microscope to confirm the presence of intracellular antigens and observe finer structures by using confocal microscope.
Figure 3.1 |
We can see several cells are injected antigens by T3SS system. But the efficiency is not high, which is related to the relative amount of cells and bacteria. And what caught our attention is that we can find green antigens in the group of pExoS54F-0301B plasmid, which support this plasmid is worked. So, we can confirm that, P. aeruginosa can inject antigens into cells in vitro.
RESULT 4.
In order to prove the safety of our system, we conduct an experiment to test whether the culture supernatant of bacterially infected cells contains the antigens.
We collect the culture supernatant of bacterially infected cells and use the TCA-acetone precipitation to precipitate the secreted proteins which may be contained in the culture supernatant. To prove the experimental operation is correct, we set a positive control of cell lysates (These cells are infected by P. aeruginosa carrying pExoS54F-mCherry). Then we analyze the sediment by western blot to figure out the existence of the secreted proteins (Figure 3). As is shown in the figure, all of the culture supernatant of bacterially infected cells do not contain the proteins, which further prove that our system is safe enough.