Team:KUAS Korea/Design

Producer strain (“cooperator”): display of β-glucosidase on the cell surface

Cheater strain: expression of GFP_uv in the cell, which acts as a reporter gene

The producer (cooperator) constitutively expresses beta-glucosidase on its surface and degrades the cellobiose.
The cooperator and the cheater take them as energy source and the cheater expresses GFPuv as a reporter gene when it takes up the glucose.
As the ratio between the cheater and cooperator changes, the total number of cooperator and cheater changes at the end.

1. Constitutive expression vector for both cheater and cooperator

Using the plasmid containing BBa_J23106 showing high-level constitutive expression, the constitutive expression vector applicable to ligation independent cloning including SwaI restriction site at the LIC site was constructed. Parts J23100 through J23119 are a family of constitutive promoter parts isolated from a small combinatorial library. The resultant LIC vector was designated as ‘pCELIC’.
Bgl1A of S. degradans was subcloned into a pATLIC vector as a previously report for the autodisplay (Ko et al., 2012) and was amplified by LA-taq polymerase by PCR. GFPuv also was amplified using α-taq polymerase by PCR. Amplified products were mixed with the linear LIC ready pCELIC vector at 1 1:4 molar ratios before transforming into DH5α.
BBa_J23106 Part-only sequence (35 bp)
tttacggctagctcagtcctaggtatagtgctagc

[Figure 1. pATLIC display system for the designed vector]

2. E.coli BW25113 as an expression host

As E.coli BW25113 is used as an display and expression host. In our experiment, cooperator expresses beta-glucosidase on its cell surface and degrades cellobiose into glucose. It is done by a surface display system using the autotransporter YfaL protein.

[Figure 2. Schematic diagrams for the domain organization of autotransporter]

[Figure 3. Autotransporter protein structure]

Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., . . . Mori, H. (2006). Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: The Keio collection. Molecular Systems Biology, 2. doi:10.1038/msb4100050
Ko, H., Park, E., Song, J., Yang, T. H., Lee, H. J., Kim, K. H., & Choi, I. (2012). Functional Cell Surface Display and Controlled Secretion of Diverse Agarolytic Enzymes by Escherichia coli with a Novel Ligation-Independent Cloning Vector Based on the Autotransporter YfaL. Applied and Environmental Microbiology, 78(9), 3051-3058. doi:10.1128/aem.07004-11
https://www.researchgate.net/figure/Autotransporter-protein-structure-and-secretion-Autotransporter-proteins-have-modular_fig1_51233167