|
|
| Line 7: |
Line 7: |
| | <div class="col-md-12"> | | <div class="col-md-12"> |
| | <h1 class="text-capitalize ct-fw-600 ct-u-colorWhite"> | | <h1 class="text-capitalize ct-fw-600 ct-u-colorWhite"> |
| − | Basic Parts | + | Parts Collection |
| | </h1> | | </h1> |
| | </div> | | </div> |
| Line 17: |
Line 17: |
| | <div class="container"> | | <div class="container"> |
| | <img src="https://static.igem.org/mediawiki/2018/7/72/T--METU_HS_Ankara--partsbanner.jpg" /> | | <img src="https://static.igem.org/mediawiki/2018/7/72/T--METU_HS_Ankara--partsbanner.jpg" /> |
| | + | |
| | + | <p> |
| | + | As the METU HS Ankara iGEM 2018 Team, we have submitted five parts for 2018 iGEM competition; two basic and three composite. |
| | + | Our basic part 1 includes FucO as the protein coding region and basic 2 includes GSH gene as the protein coding region. FucO |
| | + | aims to convert furfural to furfuryl alcohol and GSH aims to impart the overexpression of Glutathione for ultimately increasing |
| | + | ethanol yield and lifespan of the ethanologenic <i>E.coli</i> strain KO11. Our Composite part 3 includes both of the coding regions. |
| | + | All of our parts are RFC 10 compatible. FucO is obtained from <i>E.coli</i> K12 and GSH is obtained from <i>Streptococcus Thermophilus.</i> |
| | + | The table below shows all basic and composite parts submitted to iGEM Registry by our team. |
| | + | </p> |
| | <table class="table" style="font-size: 17px"> | | <table class="table" style="font-size: 17px"> |
| | <thead> | | <thead> |
| Line 41: |
Line 50: |
| | <td>Tugba Inanc & Ceyhun Kayihan</td> | | <td>Tugba Inanc & Ceyhun Kayihan</td> |
| | <td>2268bp</td> | | <td>2268bp</td> |
| | + | </tr> |
| | + | <tr class="danger"> |
| | + | <td><a href="">BBa_K2571003</a></td> |
| | + | <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td> |
| | + | <td>FucO / L-1,2-propanediol oxidoreductase</td> |
| | + | <td>Tugba Inanc & Ceyhun Kayihan</td> |
| | + | <td>1350bp</td> |
| | + | </tr> |
| | + | <tr class="warning" style="font-size: 17px"> |
| | + | <td><a href="">BBa_K2571005</a></td> |
| | + | <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td> |
| | + | <td>GSH/ Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase</td> |
| | + | <td>Tugba Inanc & Ceyhun Kayihan</td> |
| | + | <td>2466bp</td> |
| | + | </tr> |
| | + | <tr class="info"> |
| | + | <td><a href="">BBa_K2571006</a></td> |
| | + | <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td> |
| | + | <td>Dual Expression of FucO and GSH</td> |
| | + | <td>Tugba Inanc & Ceyhun Kayihan</td> |
| | + | <td>3644bp</td> |
| | </tr> | | </tr> |
| | </tbody> | | </tbody> |
| | </table> | | </table> |
| | | | |
| − | <h3>FucO <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571000">(BBa_K2571000)</a></h3> | + | <i>Table: All basic and composite parts submitted to iGEM Parts Registry by METU_HS_Ankara 2018 team</i> |
| − |
| + | |
| − | <p>
| + | |
| − | FucO is a protein-coding region that codes for L-1,2-propanediol oxidoreductase which is an NADH-linked, homodimer enzyme
| + | |
| − | having the role of acting on furfural. Furfural is a highly toxic substance which inhibits is a toxic inhibitor of microbial
| + | |
| − | fermentations causing cell wall and membrane damages, DNA breakdowns, DNA cleavages and reduced enzymatic activities
| + | |
| − | (Zheng, 2013; Liu, Ma & Song, 2009).
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | In the presence of furfural, NADPH-dependent oxidoreductases goes active in order to reduce furfural into its less toxic alcohol
| + | |
| − | derivative - furfuryl alcohol (Zheng, 2013; Wang et al., 2013; Allen et al., 2010). In this pathway, the expression of oxidoreductases
| + | |
| − | that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in E. coli by competing with biosynthesis for
| + | |
| − | NADPH (Zheng, 2013).
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions
| + | |
| − | shouldn’t be interfering with NADPH metabolism (Wang et al, 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol
| + | |
| − | oxidoreductase (FucO) gene reduces furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis
| + | |
| − | of NADPH (Wang et al, 2011).
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <div class="col-md-12 parts-photo-box">
| + | |
| − | <img src="https://static.igem.org/mediawiki/2018/c/c5/T--METU_HS_Ankara--bparts01.jpg" />
| + | |
| − | <br />
| + | |
| − | <i class="parts-info">
| + | |
| − | Figure 1: <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571000">BBa_K2571000</a>: fucO was cloned into pSB1C3.
| + | |
| − | </i>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <div style="clear: both"></div>
| + | |
| − | | + | |
| − | <div class="col-md-6">
| + | |
| − | <img width="500" src="https://static.igem.org/mediawiki/2018/6/67/T--METU_HS_Ankara--bparts02.jpg" />
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <div class="col-md-6">
| + | |
| − | <p>
| + | |
| − | We’ve inserted the gene our FucO, which is our basic part 1,to pSB1C3 backbone and transformed it to DH5- alpha. After plasmid
| + | |
| − | isolation, we’ve checked the orientation with FucO left and VR primers and expected to see a band of 625 bp.
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <div style="clear: both"></div>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | FucO and VR primers are as below:<br>
| + | |
| − | FucO left: GTGATAAGGATGCCGGAGAA<br>
| + | |
| − | VR: ATTACCGCCTTTGAGTGAGC
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <h3>GSH <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571001">(BBa_K2571001)</a></h3>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | GSH as is a protein-coding region that codes for Bifunctional gamma glutamate cysteine ligase/ Glutathione synthetase.
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | Glutathione (GSH) is known to be an important antioxidant that is a sulfur compound; a tripeptide composed of three amino acids
| + | |
| − | (cysteine, glycine and glutamic acid) and a non-protein thiol (Pizzorno, 2014; Lu, 2013). GHS is, furthermore, found in thiol-reduced
| + | |
| − | form which accounts for its strength as an antioxidant.
| + | |
| − |
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | Reactive oxygen species (ROS) are harmful substances that distort protein based matters by taking electrons and also causes oxidative
| + | |
| − | stress (Lu, 2013) which occur during the fermentation process and is another major setback. The chemical structure of the protein-based
| + | |
| − | substances such as the DNA are altered and become therefore become dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011).
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | GSH is generally found in the thiol-reduced form which is crucial for detoxification of ROS and free radicals. which cause oxidative
| + | |
| − | stress. (Lu, 2013; Burton & Jauniaux, 2011).
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | Antioxidants like GSH play an important role in the detoxification of ROS and reactive oxygen species by directly acting as electron
| + | |
| − | donors;, changing the unbalanced electron state of the free radicals and turningand, turning them into less harmful substances or affect
| + | |
| − | them indirectly by getting in the way of the expression of free radical generating enzymes (Lü et al., 2014).
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <div class="col-md-12 parts-photo-box">
| + | |
| − | <img src="https://static.igem.org/mediawiki/2018/6/62/T--METU_HS_Ankara--bparts03.jpg" />
| + | |
| − | <br>
| + | |
| − | <i class="parts-info" style="margin-bottom: 20px">
| + | |
| − | Figure 3:<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571001">BBa_K2571001</a>: GSH was cloned into pSB1C3.
| + | |
| − | </i>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <div style="clear: both"></div>
| + | |
| − | | + | |
| − | <div class="col-md-6" style="margin-bottom: 30px">
| + | |
| − | <img width="500" src="https://static.igem.org/mediawiki/2018/6/6e/T--METU_HS_Ankara--bparts04.jpg" />
| + | |
| − | <br>
| + | |
| − | <i class="parts-info">
| + | |
| − | Figure 4: BBa_K2571001 check with GSH specific primers. Expected band length: 225 bp. GSH basic well show positive results.
| + | |
| − | </i>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <div class="col-md-6">
| + | |
| − | <p>
| + | |
| − | We’ve inserted the geneour GSH, basic part 2, to pSB1C3 backbone and transformed it to DH5 alpha. After plasmid isolation,
| + | |
| − | we’ve checked the orientation with GSH specific primers and expected to see a band of 225 bp.
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <div style="clear: both"></div>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | GSH left and right primers are shown as below:
| + | |
| − | <br>
| + | |
| − | GSH left: TCGGAGGCTAAAACTCAGGA
| + | |
| − | <br>
| + | |
| − | GSH right: GTGGGCAGTCCAGTCGTAAT
| + | |
| − | </p>
| + | |
| − | | + | |
| − | | + | |
| − | <section class="ct-u-paddingTop50 ct-u-paddingBottom80 ct-u-borderBoth ct-u-backgroundGray">
| + | |
| − | <div class="container">
| + | |
| − | <div class="row">
| + | |
| − | <div class="col-md-12">
| + | |
| − | <div class="panel-group" id="accordion">
| + | |
| − | <div class="panel panel-default">
| + | |
| − | <div class="panel-heading">
| + | |
| − | <h4 class="panel-title">
| + | |
| − | <a data-toggle="collapse" data-parent="#accordion" href="#collapseOne">
| + | |
| − | References
| + | |
| − | </a>
| + | |
| − | </h4>
| + | |
| − | </div>
| + | |
| − | <div id="collapseOne" class="panel-collapse collapse">
| + | |
| − | <ul>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., … Gorsich,
| + | |
| − | S. W.</span> (2010). Furfural induces reactive oxygen species accumulation and cellular damage in
| + | |
| − | Saccharomyces cerevisiae. Biotechnology for Biofuels, 3, 2.
| + | |
| − | <a href="http://doi.org/10.1186/1754-6834-3-2">http://doi.org/10.1186/1754-6834-3-2</a>
| + | |
| − | </li>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">Chou, H.-H., Marx, C. J., & Sauer, U.</span> (2015). Transhydrogenase Promotes the Robustness and Evolvability of
| + | |
| − | E. coli Deficient in NADPH Production. PLoS Genetics, 11(2), e1005007.
| + | |
| − | <a href="http://doi.org/10.1371/journal.pgen.1005007">http://doi.org/10.1371/journal.pgen.1005007</a>
| + | |
| − | </li>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">Liu, Z.L., Ma M., Song, M.</span>(2009). Evolutionarily engineered ethanologenic yeast detoxifies lignocellulosic
| + | |
| − | biomass conversion inhibitors by reprogrammed pathways. Mol Genet Genomics 282, 233-244. doi:
| + | |
| − | 10.1007/s00438-009-0461-7
| + | |
| − | </li>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">Wang, X., Miller, E. N., Yomano, L. P., Zhang, X., Shanmugam, K. T., & Ingram, L. O.</span> (2011). Increased
| + | |
| − | Furfural Tolerance Due to Overexpression of NADH-Dependent Oxidoreductase FucO in Escherichia coli Strains
| + | |
| − | Engineered for the Production of Ethanol and Lactate. Applied and Environmental Microbiology, 77(15),
| + | |
| − | 5132–5140. <a href="http://doi.org/10.1128/AEM.05008-11">http://doi.org/10.1128/AEM.05008-11</a>
| + | |
| − | </li>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">Zheng, H., Wang, X., Yomano, L.P., Geddes, R.D, Shanmugan, K. T., Ingram, L.O.</span> (2013). Improving
| + | |
| − | Escherichia coli FucO for Furfural Tolerance by Saturation Mutagenesis of Individual Amino Acid Positions.
| + | |
| − | Applied and Environmental Microbiology Vol 79, no 10. 3202–3208.
| + | |
| − | <a href="http://aem.asm.org/content/79/10/3202.full.pdf+html">http://aem.asm.org/content/79/10/3202.full.pdf+html</a>
| + | |
| − | </li>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">Lu, S. C.</span> (2013). Glutathione Synthesis. Biochemical et Biophysica Acta, 1830(5), 3143–3153.
| + | |
| − | <a href="http://doi.org/10.1016/j.bbagen.2012.09.008">http://doi.org/10.1016/j.bbagen.2012.09.008</a>
| + | |
| − | </li>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">National Center for Biotechnology Information.</span> PubChem Compound Database; CID=124886,
| + | |
| − | <a href="https://pubchem.ncbi.nlm.nih.gov/compound/124886">https://pubchem.ncbi.nlm.nih.gov/compound/124886</a> (accessed July 18, 2018).
| + | |
| − | <a href="https://pubchem.ncbi.nlm.nih.gov/compound/124886#section=Top">https://pubchem.ncbi.nlm.nih.gov/compound/124886#section=Top</a>
| + | |
| − | </li>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">Pizzorno, J.</span> (2014). Glutathione! Integrative Medicine: A Clinician’s Journal, 13(1), 8–12.
| + | |
| − | <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/">https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/</a>
| + | |
| − | </li>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">Burton, G. J., & Jauniaux, E.</span> (2011). Oxidative stress. Best Practice & Research. Clinical Obstetrics &
| + | |
| − | Gynaecology, 25(3), 287–299.
| + | |
| − | <a href="http://doi.org/10.1016/j.bpobgyn.2010.10.016">http://doi.org/10.1016/j.bpobgyn.2010.10.016</a>
| + | |
| − | </li>
| + | |
| − | <li>
| + | |
| − | <span style="font-weight:bold">Lü, J.-M., Lin, P. H., Yao, Q., & Chen, C.</span> (2010). Chemical and molecular mechanisms of antioxidants:
| + | |
| − | experimental approaches and model systems. Journal of Cellular and Molecular Medicine, 14(4), 840–860.
| + | |
| − | <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/">http://doi.org/10.1111/j.1582-4934.2009.00897.x</a>
| + | |
| − | </li>
| + | |
| − | </ul>
| + | |
| − |
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </section>
| + | |
| | | | |
| | </div> | | </div> |
