Difference between revisions of "Team:UI Indonesia/Parts"

 
(25 intermediate revisions by 3 users not shown)
Line 141: Line 141:
 
margin:0px;border:0px;}
 
margin:0px;border:0px;}
 
h5{
 
h5{
font-size:24px;
+
font-size:20px;
 
text-align:justify;
 
text-align:justify;
 
}
 
}
 +
h6{
 +
font-size:16px;
 +
}
 +
.ref{
 +
font-size:18px;
 +
}
 +
#myBtn {
 +
  display: none;
 +
  position: fixed;
 +
  bottom: 20px;
 +
  right: 30px;
 +
  z-index: 99;
 +
  font-size: 18px;
 +
  border: none;
 +
  outline: none;
 +
  background-color:transparent;
 +
  color: white;
 +
  cursor: pointer;
 +
  padding: 15px;
 +
  border-radius: 4px;
 +
}
 +
 +
#myBtn:hover {
 +
  background-color: #555;
 +
}
 +
 +
table {
 +
    font-family: arial, sans-serif;
 +
    border-collapse: collapse;
 +
    width: 100%;
 +
}
 +
 +
td, th {
 +
    border: 1px solid #dddddd;
 +
    text-align: left;
 +
    padding: 8px;
 +
}
 +
 +
tr:first-child {
 +
    background-color: #dddddd;
 
</style>
 
</style>
  
 
<body>
 
<body>
 +
<button onclick="topFunction()" id="myBtn" title="Go to top"><img src="https://image.flaticon.com/icons/png/512/14/14747.png" style="width:50px;height:50px;"></button>
 +
 
<!-- Navbar -->
 
<!-- Navbar -->
 
<nav class="navbar navbar-default">
 
<nav class="navbar navbar-default">
Line 170: Line 212:
 
         </li>
 
         </li>
 
         <li class="navbar-parts current"><a href="https://2018.igem.org/Team:UI_Indonesia/Parts">Parts</a></li>
 
         <li class="navbar-parts current"><a href="https://2018.igem.org/Team:UI_Indonesia/Parts">Parts</a></li>
<li class="navbar-safety"><a href="https://2018.igem.org/Team:UI_Indonesia/Safety">Safety</a></li>
+
    <li class="navbar-safety"><a href="https://2018.igem.org/Team:UI_Indonesia/Safety">Safety</a></li>
<li class="dropdown navbar-interlab">
+
    <li class="dropdown navbar-interlab">
 
           <a href="https://2018.igem.org/Team:UI_Indonesia/InterLab">InterLab<span class="caret"></span></a>
 
           <a href="https://2018.igem.org/Team:UI_Indonesia/InterLab">InterLab<span class="caret"></span></a>
 
           <ul class="dropdown-menu">
 
           <ul class="dropdown-menu">
Line 177: Line 219:
 
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/InterLab#materials">Materials and Equipment</a></li>
 
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/InterLab#materials">Materials and Equipment</a></li>
 
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/InterLab#methods">Methods</a></li>
 
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/InterLab#methods">Methods</a></li>
<li><a href="https://2018.igem.org/Team:UI_Indonesia/InterLab#results">Results and Discussions</a></li>
+
      <li><a href="https://2018.igem.org/Team:UI_Indonesia/InterLab#results">Results and Discussions</a></li>
<li><a href="https://2018.igem.org/Team:UI_Indonesia/InterLab#conclusions">Conclusions</a></li>
+
      <li><a href="https://2018.igem.org/Team:UI_Indonesia/InterLab#conclusions">Conclusions</a></li>
 
           </ul>
 
           </ul>
 
         </li>
 
         </li>
<li class="navbar-model"><a href="https://2018.igem.org/Team:UI_Indonesia/Model">Model</a></li>
+
    <li class="navbar-model"><a href="https://2018.igem.org/Team:UI_Indonesia/Model">Model</a></li>
<li class="dropdown navbar-humanpractice">
+
    <li class="dropdown navbar-humanpractice">
           <a href="https://2018.igem.org/Team:UI_Indonesia/HumanPractices">Human Practices<span class="caret"></span></a>
+
           <a href="https://2018.igem.org/Team:UI_Indonesia/Human_Practices">Human Practices<span class="caret"></span></a>
 
           <ul class="dropdown-menu">
 
           <ul class="dropdown-menu">
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/HumanPractices#collapse1">Campus Campaign</a></li>
+
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/Human_Practices">Integrated Human Practice</a></li>
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/HumanPractices#collapse2">Social Work</a></li>
+
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/Public_Engagement">Education and Public Engagement</a></li>
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/HumanPractices#collapse3">Biosafety & Biosecurity Training</a></li>
+
             <li><a href="https://2018.igem.org/Team:UI_Indonesia/Human_Practices#catalogue">Human Practice Catalogue</a></li>
<li><a href="https://2018.igem.org/Team:UI_Indonesia/HumanPractices#collapse4">Human Practice Catalogue</a></li>
+
          </ul>
 +
    </li>
 +
    <li class="navbar-improve"><a href="https://2018.igem.org/Team:UI_Indonesia/Improve">Improve</a></li>
 +
    <li class="navbar-team"><a href="https://2018.igem.org/Team:UI_Indonesia/Team">Team</a></li>
 +
    <li class="navbar-collaborations"><a href="https://2018.igem.org/Team:UI_Indonesia/Collaborations">Collaborations</a></li>
 +
        <li class="dropdown navbar-attributions">
 +
          <a href="https://2018.igem.org/Team:UI_Indonesia/Attributions">Attributions<span class="caret"></span></a>
 +
          <ul class="dropdown-menu">
 +
            <li><a href="https://2018.igem.org/Team:UI_Indonesia/MedalCriteria">Medal Criteria</a></li>
 
           </ul>
 
           </ul>
 
         </li>
 
         </li>
<li class="navbar-improve"><a href="https://2018.igem.org/Team:UI_Indonesia/Improve">Improve</a></li>
 
<li class="navbar-team"><a href="https://2018.igem.org/Team:UI_Indonesia/Team">Team</a></li>
 
<li class="navbar-collaborations"><a href="https://2018.igem.org/Team:UI_Indonesia/Collaborations">Collaborations</a></li>
 
<li class="navbar-attributions"><a href="https://2018.igem.org/Team:UI_Indonesia/Attributions">Attributions</a></li>
 
 
       </ul>
 
       </ul>
 
     </div>
 
     </div>
Line 204: Line 250:
 
<div class="bgimg-3 w3-display-container w3-opacity-min" id="affitoxin">
 
<div class="bgimg-3 w3-display-container w3-opacity-min" id="affitoxin">
 
   <div class="w3-display-middle" style="white-space:nowrap;">
 
   <div class="w3-display-middle" style="white-space:nowrap;">
     <span class="w3-center w3-padding-large w3-black w3-xlarge w3-wide w3-animate-opacity">AFFITOXIN</span>
+
     <span class="w3-center w3-padding-large w3-black w3-xlarge w3-wide w3-animate-opacity">DIPHTOX</span>
 
   </div>
 
   </div>
 
</div>
 
</div>
  
 
<div class="w3-content w3-container w3-padding-64">
 
<div class="w3-content w3-container w3-padding-64">
   <h5>Using the <i>wild-type</i> diphtheria exotoxin to characterize HBEGF-TAR receptor could be harmful due to biosafety reason. To tackle this problem, our team design a much simplified diphtheria toxin by removing the domain that is deadly to the cell. This domain, named domain C, will be translocated into the cell with the aid of other domains in toxin called domain R and domain T. Additionally, R domain recognized the natural HBEGF receptor, and T domain will insert the C domain into the cell. Thus, C domain would catalyze NAD-dependent ADP-ribosylation of EF-2 and leads to cellular apoptosis<sup>1</sup>. This remodeled toxin, coined Affitoxin, is incorporated in the plasmids (such as pSB1C3 and pEQ80L) along with the following parts.</h5><br>
+
   <h5>Using the <i>wild-type</i> diphtheria exotoxin to characterize HB-EGF/Tar receptor could be harmful due to biosafety reason. To tackle this problem, our team design a much simplified diphtheria toxin by removing the domain that is deadly to the cell. This domain, named domain C, will be translocated into the cell with the aid of other domains in toxin called domain R and domain T. Additionally, R domain recognized the natural HBEGF receptor, and T domain will insert the C domain into the cell. Thus, C domain would catalyze NAD-dependent ADP-ribosylation of EF-2 and leads to cellular apoptosis<sup>1</sup>. This remodeled toxin, coined DiphTox, is incorporated in the plasmids (such as pSB1C3 and pEQ80L) along with the following parts.</h5><br>
  
 
   <div class="w3-row w3-center">
 
   <div class="w3-row w3-center">
     <img src="https://static.igem.org/mediawiki/2018/1/11/T--UI_Indonesia--partsf1.png" class="w3-image" width="500">
+
     <img src="https://static.igem.org/mediawiki/2018/5/54/T--UI_Indonesia--partsf1diphtox.png" class="w3-image" width="500">
   <h6><b>Figure 1.</b> Affitoxin Biobrick.</h6></div><br>
+
   <h6><b>Figure 1.</b> DiphTox Biobrick.</h6></div><br>
  
   <h5>Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev). The following sequences are the primers for PCR cloning.
+
   <h5>Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev). The following sequences are the primers for PCR cloning.</h5>
 
   <br>
 
   <br>
     <ol>
+
  <div class="w3-row w3-center">
       <li>PCR cloning primer forward : 5’ AGTTCAAGTGTCCGAGAA 3’<br>Specifications:</li>
+
     <table>
         <ul style="list-style-type:circle">
+
       <tr>
          <li>Melting Temperature (Tm) : 60.2<sup>o</sup>C</li>
+
        <th>Primers</th>
          <li>GC content : 44.4%</li>
+
         <th>Sequence</th>
          <li>Hairpin structure energy formation : 0.64 kcal/mol</li>
+
        <th>Melting Temperatures (Tm)</th>
          <li>Self-dimer energy formation : -3.61 kcal/mol</li>
+
        <th>GC Content (%)</th>
        </ul>
+
        <th>Hairpin Structure Energy Formation (kcal/mol)</th>
       <li>PCR cloning primer reverse : 5’ TAAGCGAGTGCCGTATTA 3’<br>Specifications:</li>
+
        <th>Self-dimer Energy Formation (kcal/mol)</th>
         <ul style="list-style-type:circle">
+
      </tr>
          <li>Melting Temperature (Tm) : 60.1<sup>o</sup>C</li>
+
      <tr>
          <li>GC content : 44.4%</li>
+
        <td>Fwd Cloning</td>
          <li>Hairpin structure energy formation : -1.36 kcal/mol</li>
+
        <td>5’ AGTTCAAGTGTCCGAGAA 3’</td>
          <li>Self-dimer energy formation : -3.61 kcal/mol</li>
+
        <td>60.2<sup>0</sup>C</td>
        </ul>
+
        <td>44.4%</td>
     </ol>
+
        <td>0.64</td>
 +
        <td>-3.61</td>
 +
      </tr>
 +
       <tr>
 +
        <td>Rev Cloning</td>
 +
         <td>5’ TAAGCGAGTGCCGTATTA 3’</td>
 +
        <td>60.1<sup>0</sup>C</td>
 +
        <td>44.4%</td>
 +
        <td>-1.36</td>
 +
        <td>-3.61</td>
 +
      </tr>
 +
    </table>
 +
     <h6><b>Table 1.</b> PCR Cloning Amplification Primers</h6>
 +
  </div>
 
   <br>
 
   <br>
   Note: Both heterodimer energy formations are -3.61 kcal/mol. Additionally, the predicted specifications are based on <i>IDT Oligo Analyzer 3.1</i> <a href="https://sg.idtdna.com/calc/analyzer" style="color:blue">server.</a> PCR solution is predicted to contain 0.2 mM dNTP, 50 mM Na<sup>+</sup>, 5 mM Mg<sup>2+</sup>, and 0.3 mM oligos.
+
   <h5>Note: Both heterodimer energy formations are -3.61 kcal/mol. Additionally, the predicted specifications are based on <i>IDT Oligo Analyzer 3.1</i> <a href="https://sg.idtdna.com/calc/analyzer" style="color:blue">server.</a> PCR solution is predicted to contain 0.2 mM dNTP, 50 mM Na<sup>+</sup>, 5 mM Mg<sup>2+</sup>, and 0.3 mM oligos.
 
   </h5><br>
 
   </h5><br>
  
   <h5>Confirmation of gBlocks insertion into plasmid could be confirmed using PCR colony method using following primer. Note that HbT1 Fwd and HbT2 Rev is the same primer used in HT fragments to do PCR colony in Affitoxin gBlocks.
+
   <h5>Confirmation of gBlocks insertion into plasmid could be confirmed using PCR colony method using following primer. Note that HbT1 Fwd and HbT2 Rev is the same primer used in HT fragments to do in DipthTox gBlocks.</h5>
 
   <br>
 
   <br>
     <ol>
+
  <div class="w3-row w3-center">
       <li>Primer HbT1 Fwd : 5’ CTTACGCTTCTGCCACAT 3’<br>Specifications:</li>
+
     <table>
         <ul style="list-style-type:circle">
+
       <tr>
          <li>Melting Temperature (Tm) : 61.7<sup>o</sup>C</li>
+
        <th>Primers</th>
          <li>GC content : 50%</li>
+
         <th>Sequence</th>
          <li>Hairpin structure energy formation : -0.84 kcal/mol</li>
+
        <th>Melting Temperatures (Tm)</th>
          <li>Self-dimer energy formation : -3.61 kcal/mol</li>
+
        <th>GC Content (%)</th>
        </ul>
+
        <th>Hairpin Structure Energy Formation (kcal/mol)</th>
       <li>Primer HbT2 rev : 5’ CCCCTGACTGAGCATGAT 3’<br>Specifications:</li>
+
        <th>Self-dimer Energy Formation (kcal/mol)</th>
         <ul style="list-style-type:circle">
+
      </tr>
          <li>Melting Temperature (Tm) : 62.8<sup>o</sup>C</li>
+
      <tr>
          <li>GC content : 55.6%</li>
+
        <td>HbT1 Fwd</td>
          <li>Hairpin structure energy formation : 0.57 kcal/mol</li>
+
        <td>5’ CTTACGCTTCTGCCACAT 3’</td>
          <li>Self-dimer energy formation : -5.38 kcal/mol</li>
+
        <td>61.7<sup>0</sup>C</td>
        </ul>
+
        <td>50%</td>
     </ol>
+
        <td>-0.84</td>
 +
        <td>-3.61</td>
 +
      </tr>
 +
       <tr>
 +
        <td>HbT2 Rev</td>
 +
         <td>5’ CCCCTGACTGAGCATGAT 3’</td>
 +
        <td>62.8<sup>0</sup>C</td>
 +
        <td>55.6%</td>
 +
        <td>0.57</td>
 +
        <td>-5.38</td>
 +
      </tr>
 +
    </table>
 +
     <h6><b>Table 2.</b> Detailed data for DiphTox PCR colony primers</h6><br>
 +
  </div>
 
   <br>
 
   <br>
   Note: Both heterodimer energy formation exhibits -5.04 kcal/mol free energy.
+
   <h5>Note: Both heterodimer energy formation exhibits -5.04 kcal/mol free energy.</h5><br>
  </h5><br>
+
  
   <h5>For iGEM biobrick submission, we would use prefix and suffix that contain EcoRI and PstI. HindIII site and BamHI are inserted upstream from prefix and downstream from suffix respectively. The Affitoxin contains only the last 54 amino acid from the R domain which has no cytotoxicity and significant enough to bind with HBEGF receptor<sup>2</sup>. At the downstream of the sequence, designing six histidine amino acids is essential for His-tag protein purification, as well as characterizing the affitoxin and HBEGF-TAR receptor kinetics. Ribosome Binding Site (RBS) is located upstream within the gBlocks containing Shine-Dalgarno sequence as follow.<br>
+
   <h5>For iGEM biobrick submission, we would use prefix and suffix that contain EcoRI and PstI. Further characterization of the biobrick of DiphTox could be accessed via <a href="http://parts.igem.org/Part:BBa_K2607000" style="color:blue">http://parts.igem.org/Part:BBa_K2607000</a>. HindIII site and BamHI are inserted upstream from prefix and downstream from suffix respectively. The DiphTox contains only the last 54 amino acid from the R domain which has no cytotoxicity and significant enough to bind with HBEGF receptor<sup>2</sup>. At the downstream of the sequence, designing six histidine amino acids is essential for His-tag protein purification, as well as characterizing the DiphTox and HB-EGF/Tar receptor kinetics. Ribosome Binding Site (RBS) is located upstream within the gBlocks containing Shine-Dalgarno sequence as follow.<br>
 
   RBS : 5' GAGCGGATTATATAAGGAGGTTAATC 3’
 
   RBS : 5' GAGCGGATTATATAAGGAGGTTAATC 3’
 
   </h5><br>
 
   </h5><br>
 
</div>
 
</div>
  
<!-- Container (HBEGF-Tar Section) -->
+
<!-- Container (HB-EGF/Tar Section) -->
 
<div class="bgimg-3 w3-display-container w3-opacity-min" id="hbegftar">
 
<div class="bgimg-3 w3-display-container w3-opacity-min" id="hbegftar">
 
   <div class="w3-display-middle" style="white-space:nowrap;">
 
   <div class="w3-display-middle" style="white-space:nowrap;">
     <span class="w3-center w3-padding-large w3-black w3-xlarge w3-wide w3-animate-opacity">HBEGF-TAR</span>
+
     <span class="w3-center w3-padding-large w3-black w3-xlarge w3-wide w3-animate-opacity">HB-EGF/Tar</span>
 
   </div>
 
   </div>
 
</div>
 
</div>
  
 
<div class="w3-content w3-container w3-padding-64">
 
<div class="w3-content w3-container w3-padding-64">
   <h5>HBEGF-TAR is a synthetically combined receptor used as project’s diagnostic tool system. Since there was limitation in its biobrick construction (for its high DNA complexity and base pairs length as <i>gBlocks</i>), we separate the HBEGF-TAR sequence into two fragments called HBEGF-TAR Fragment 1 (HT-1) in the upstream, and the other one would be HBEGF-TAR Fragment 2 (HT-2). The schematic structure of HT-1 biobrick is as follow.</h5><br>
+
   <h5>HB-EGF/Tar is a synthetically combined receptor used as project’s diagnostic tool system. Since there was limitation in its biobrick construction (for its high DNA complexity and base pairs length as <i>gBlocks</i>), we separate the HB-EGF/Tar sequence into two fragments called HB-EGF/Tar Fragment 1 (HT-1) in the upstream, and the other one would be HB-EGF/Tar Fragment 2 (HT-2). The schematic structure of HT-1 biobrick is as follow.</h5><br>
  
 
   <div class="w3-row w3-center">
 
   <div class="w3-row w3-center">
 
     <img src="https://static.igem.org/mediawiki/2018/c/c3/T--UI_Indonesia--partsf2.png" class="w3-image" width="500">
 
     <img src="https://static.igem.org/mediawiki/2018/c/c3/T--UI_Indonesia--partsf2.png" class="w3-image" width="500">
   <h6><b>Figure 2.</b> HBEGF-TAR Fragment 1 Biobrick.</h6></div><br>
+
   <h6><b>Figure 2.</b> HB-EGF/Tar Fragment 1 Biobrick.</h6></div><br>
  
   <h5>The HT-1 fragment consist of 981 bp sequence that include <i>SalI</i> cutting site and specified PCR colony reverse primer (HbT1 rev). Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev), which are the same as cloning primer for affitoxin gBlocks.</h5><br>
+
   <h5>The HT-1 fragment consist of 981 bp sequence that include <i>SalI</i> cutting site and specified PCR colony reverse primer (HbT1 rev). Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev), which are the same as cloning primer for DiphTox gBlocks.</h5><br>
  
   <h5>For confirmation of this biobrick existence inside <i>E. coli</i>, PCR colony is essential, using specific primers named “PCR colony HbT1 fwd” for forward primer and “PCR colony HbT1 rev” for reverse primer. They are constructed using NCBI primer BLAST <a href="https://www.ncbi.nlm.nih.gov/tools/primer-blast/" style="color:blue">website.</a> The sequences are served as follows.
+
   <h5>For confirmation of this biobrick existence inside <i>E. coli</i>, PCR colony is essential, using specific primers named “PCR colony HbT1 fwd” for forward primer and “PCR colony HbT1 rev” for reverse primer. They are constructed using NCBI primer BLAST <a href="https://www.ncbi.nlm.nih.gov/tools/primer-blast/" style="color:blue">website.</a> The sequences are served as follows.</h5>
 
   <br>
 
   <br>
     <ol>
+
  <div class="w3-row w3-center">
       <li>Primer HbT1 Fwd : 5’ CTTACGCTTCTGCCACAT 3’<br>Specifications:</li>
+
     <table>
         <ul style="list-style-type:circle">
+
       <tr>
          <li>Melting Temperature (Tm) : 61.7<sup>o</sup>C</li>
+
        <th>Primers</th>
          <li>GC content : 50%</li>
+
         <th>Sequence</th>
          <li>Hairpin structure energy formation : -0.84 kcal/mol</li>
+
        <th>Melting Temperatures (Tm)</th>
          <li>Self-dimer energy formation : -3.61 kcal/mol</li>
+
        <th>GC Content (%)</th>
        </ul>
+
        <th>Hairpin Structure Energy Formation (kcal/mol)</th>
       <li>Primer HbT1 Rev : 5’ TTCTTACGCTTCCCATGTTC 3’<br>Specifications:</li>
+
        <th>Self-dimer Energy Formation (kcal/mol)</th>
         <ul style="list-style-type:circle">
+
      </tr>
          <li>Melting Temperature (Tm) : 62.1<sup>o</sup>C</li>
+
      <tr>
          <li>GC content : 45%</li>
+
        <td>HbT1 Fwd</td>
          <li>Hairpin structure energy formation : 0.64 kcal/mol</li>
+
        <td>5’ CTTACGCTTCTGCCACAT 3’</td>
          <li>Self-dimer energy formation : -5.38 kcal/mol</li>
+
        <td>61.7<sup>0</sup>C</td>
        </ul>
+
        <td>50%</td>
     </ol>
+
        <td>-0.84</td>
 +
        <td>-3.61</td>
 +
      </tr>
 +
       <tr>
 +
        <td>HbT1 Rev</td>
 +
        <td>5’ TTCTTACGCTTCCCATGTTC 3’</td>
 +
         <td>62.1<sup>0</sup>C</td>
 +
        <td>45%</td>
 +
        <td>0.64</td>
 +
        <td>-5.38</td>
 +
      </tr>
 +
    </table>
 +
     <h6><b>Table 3.</b> Detailed data for HT1 PCR colony primers</h6><br>
 +
  </div>
 
   <br>
 
   <br>
   Note: Both heterodimer energy formations are -4.77 kcal/mol.
+
   <h5>Note: Both heterodimer energy formations are -4.77 kcal/mol.</h5><br>
  </h5><br>
+
  
   <h5>Biobrick RFC10 prefix is necessary and would be cut using EcoRI enzyme for submission. Active gene transcription includes highly expressing T7 constitutive promoter (Bba_I712074) located in the upstream part of HT-1. Ribosomal binding site (RBS) (Bba_B0034) functions to initiate direct HBEGF-TAR translation (HbTf1-RBS). It is 18 bp in length with the following sequence, 5' AAAGAGGAGAAATACTAG 3’, conformed with Shine-Dalgarno sequence
+
   <h5>Biobrick RFC10 prefix is necessary and would be cut using EcoRI enzyme for submission. Active gene transcription includes highly expressing T7 constitutive promoter (Bba_I712074) located in the upstream part of HT-1. Ribosomal binding site (RBS) (Bba_B0034) functions to initiate direct HB-EGF/Tar translation (HbTf1-RBS). It is 18 bp in length with the following sequence, 5' AAAGAGGAGAAATACTAG 3’, conformed with Shine-Dalgarno sequence
 
   <br>
 
   <br>
   The next fragment of HbEGF-Tar Sequence, called HbEGF-Tar Fragment 2 (HT-2), will be ligated exactly next to the first one via SalI restriction site. Schematic representation of HbEGF-Tar Fragment 2 is as follow.</h5><br>
+
   The next fragment of HB-EGF/Tar Sequence, called HB-EGF/Tar Fragment 2 (HT-2), will be ligated exactly next to the first one via SalI restriction site. Schematic representation of HB-EGF/Tar Fragment 2 is as follow.</h5><br>
  
 
   <div class="w3-row w3-center">
 
   <div class="w3-row w3-center">
 
     <img src="https://static.igem.org/mediawiki/2018/0/04/T--UI_Indonesia--partsf3.png" class="w3-image" width="500">
 
     <img src="https://static.igem.org/mediawiki/2018/0/04/T--UI_Indonesia--partsf3.png" class="w3-image" width="500">
   <h6><b>Figure 3.</b> HbEGF-Tar Fragment 2 Biobrick.</h6></div><br>
+
   <h6><b>Figure 3.</b> HB-EGF/Tar Fragment 2 Biobrick.</h6></div><br>
  
   <h5>To amplify this part, we would use universal PCR cloning forward and reverse primers with their sequences same as HT-1 and Affitoxin gBlocks. PCR colony, with a specific primer named “HbT2 fwd” for forward primer and “HbT2 Rev” for reverse primer, could be used to confirm any successful transformation of ligated insert. Both primers are constructed with NCBI primer BLAST website and have the sequence detailed below.
+
   <h5>To amplify this part, we would use universal PCR cloning forward and reverse primers with their sequences same as HT-1 and DiphTox gBlocks. PCR colony, with a specific primer named “HbT2 fwd” for forward primer and “HbT2 Rev” for reverse primer, could be used to confirm any successful transformation of ligated insert. Both primers are constructed with NCBI primer BLAST website and have the sequence detailed below.</h5>
 
   <br>
 
   <br>
     <ol>
+
  <div class="w3-row w3-center">
       <li>Primer HbT2 fwd : 5’ GTTAGCGGTCTCAGAAATGG 3’<br>Specifications:</li>
+
     <table>
         <ul style="list-style-type:circle">
+
       <tr>
          <li>Melting Temperature (Tm) : 62.2<sup>o</sup>C</li>
+
        <th>Primers</th>
          <li>GC content : 50%</li>
+
         <th>Sequence</th>
          <li>Hairpin structure energy formation : -1.15 kcal/mol</li>
+
        <th>Melting Temperatures (Tm)</th>
          <li>Self-dimer energy formation : -3.61 kcal/mol</li>
+
        <th>GC Content (%)</th>
        </ul>
+
        <th>Hairpin Structure Energy Formation (kcal/mol)</th>
       <li>Primer HbT2 rev : 5’ CCCCTGACTGAGCATGAT 3’<br>Specifications:</li>
+
        <th>Self-dimer Energy Formation (kcal/mol)</th>
         <ul style="list-style-type:circle">
+
      </tr>
          <li>Melting Temperature (Tm) : 62.8<sup>o</sup>C</li>
+
      <tr>
          <li>GC content : 55.6%</li>
+
        <td>HbT2 Fwd</td>
          <li>Hairpin structure energy formation : 0.57 kcal/mol</li>
+
        <td>5’ GTTAGCGGTCTCAGAAATGG 3’</td>
          <li>Self-dimer energy formation : -5.38 kcal/mol</li>
+
        <td>62.2<sup>0</sup>C</td>
        </ul>
+
        <td>50%</td>
     </ol>
+
        <td>-1.15</td>
 +
        <td>-3.61</td>
 +
      </tr>
 +
       <tr>
 +
        <td>HbT2 Rev</td>
 +
         <td>5’ CCCCTGACTGAGCATGAT 3’</td>
 +
        <td>62.8<sup>0</sup>C</td>
 +
        <td>55.6%</td>
 +
        <td>0.57</td>
 +
        <td>-5.38</td>
 +
      </tr>
 +
    </table>
 +
     <h6><b>Table 4.</b> detailed data for HT2 PCR colony primers</h6><br>
 +
  </div>
 
   <br>
 
   <br>
   Note: Both heterodimer energy formations are -6.73 kcal/mol.
+
   <h5>Note: Both heterodimer energy formations are -6.73 kcal/mol.</h5><br>
  </h5><br>
+
 
    
 
    
   <h5>In this fragment, SalI and NdeI are in upstream and downstream respectively. This arrangement would enable that HBEGF-TAR frag 1 and HBEGF-TAR frag 2 be next to each other and transcribed as a unity. At the end part of the coding region we add double terminator rrnB T1 and T7TE terminator (Bba_B0015). These terminators have been known to effectively terminate transcription of any gene. We shall submit the overall HBEGF-TAR biobrick sequence by inserting iGEM registered RFC10 suffix that contain PstI restriction site at the downstream of the coding region. The prefix, as mentioned earlier, is inserted in the first fragment of the HBEGF-TAR sequence.
+
   <h5>In this fragment, SalI and NdeI are in upstream and downstream respectively. This arrangement would enable that HB-EGF/Tar frag 1 and HB-EGF/Tar frag 2 be next to each other and transcribed as a unity. At the end part of the coding region we add double terminator rrnB T1 and T7TE terminator (Bba_B0015). These terminators have been known to effectively terminate transcription of any gene. We shall submit the overall HB-EGF/Tar biobrick sequence by inserting iGEM registered RFC10 suffix that contain PstI restriction site at the downstream of the coding region. The prefix, as mentioned earlier, is inserted in the first fragment of the HB-EGF/Tar sequence. Further characterization of the biobrick of complete HB-EGF/Tar synthetic gene could be accessed via Further characterization of the biobrick of DiphTox could be accessed via <a href="http://parts.igem.org/Part:BBa_K2607001" style="color:blue">http://parts.igem.org/Part:BBa_K2607001</a>.
 
   </h5><br>
 
   </h5><br>
  
 
   <h5><b>Reference</b>
 
   <h5><b>Reference</b>
     <ol>
+
     <ol class="ref">
 
       <li>Gillet D, Barbier J. Diphtheria toxin. The Comprehensive Sourcebook of Bacterial Protein Toxins. 2015;:111-132.</li>
 
       <li>Gillet D, Barbier J. Diphtheria toxin. The Comprehensive Sourcebook of Bacterial Protein Toxins. 2015;:111-132.</li>
 
       <li>2.  Rolf J, Eidels L. Characterization of the diphtheria toxin receptor-binding domain. Molecular Microbiology. 1993;7(4):585-591.</li>
 
       <li>2.  Rolf J, Eidels L. Characterization of the diphtheria toxin receptor-binding domain. Molecular Microbiology. 1993;7(4):585-591.</li>
Line 343: Line 438:
 
   <script src="https://ajax.googleapis.com/ajax/libs/jquery/3.3.1/jquery.min.js"></script>
 
   <script src="https://ajax.googleapis.com/ajax/libs/jquery/3.3.1/jquery.min.js"></script>
 
   <script src="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.7/js/bootstrap.min.js"></script>
 
   <script src="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.7/js/bootstrap.min.js"></script>
 +
<script>
 +
// When the user scrolls down 20px from the top of the document, show the button
 +
window.onscroll = function() {scrollFunction()};
 +
 +
function scrollFunction() {
 +
    if (document.body.scrollTop > 20 || document.documentElement.scrollTop > 20) {
 +
        document.getElementById("myBtn").style.display = "block";
 +
    } else {
 +
        document.getElementById("myBtn").style.display = "none";
 +
    }
 +
}
 +
 +
// When the user clicks on the button, scroll to the top of the document
 +
function topFunction() {
 +
    document.body.scrollTop = 0;
 +
    document.documentElement.scrollTop = 0;
 +
}
 +
</script>
 
<!-- Footer -->
 
<!-- Footer -->
 
<footer class="w3-center w3-green w3-padding-64 w3-opacity w3-hover-opacity-off">
 
<footer class="w3-center w3-green w3-padding-64 w3-opacity w3-hover-opacity-off">

Latest revision as of 08:11, 17 October 2018

DIPHTOX
Using the wild-type diphtheria exotoxin to characterize HB-EGF/Tar receptor could be harmful due to biosafety reason. To tackle this problem, our team design a much simplified diphtheria toxin by removing the domain that is deadly to the cell. This domain, named domain C, will be translocated into the cell with the aid of other domains in toxin called domain R and domain T. Additionally, R domain recognized the natural HBEGF receptor, and T domain will insert the C domain into the cell. Thus, C domain would catalyze NAD-dependent ADP-ribosylation of EF-2 and leads to cellular apoptosis1. This remodeled toxin, coined DiphTox, is incorporated in the plasmids (such as pSB1C3 and pEQ80L) along with the following parts.

Figure 1. DiphTox Biobrick.

Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev). The following sequences are the primers for PCR cloning.

Primers Sequence Melting Temperatures (Tm) GC Content (%) Hairpin Structure Energy Formation (kcal/mol) Self-dimer Energy Formation (kcal/mol)
Fwd Cloning 5’ AGTTCAAGTGTCCGAGAA 3’ 60.20C 44.4% 0.64 -3.61
Rev Cloning 5’ TAAGCGAGTGCCGTATTA 3’ 60.10C 44.4% -1.36 -3.61
Table 1. PCR Cloning Amplification Primers

Note: Both heterodimer energy formations are -3.61 kcal/mol. Additionally, the predicted specifications are based on IDT Oligo Analyzer 3.1 server. PCR solution is predicted to contain 0.2 mM dNTP, 50 mM Na+, 5 mM Mg2+, and 0.3 mM oligos.

Confirmation of gBlocks insertion into plasmid could be confirmed using PCR colony method using following primer. Note that HbT1 Fwd and HbT2 Rev is the same primer used in HT fragments to do in DipthTox gBlocks.

Primers Sequence Melting Temperatures (Tm) GC Content (%) Hairpin Structure Energy Formation (kcal/mol) Self-dimer Energy Formation (kcal/mol)
HbT1 Fwd 5’ CTTACGCTTCTGCCACAT 3’ 61.70C 50% -0.84 -3.61
HbT2 Rev 5’ CCCCTGACTGAGCATGAT 3’ 62.80C 55.6% 0.57 -5.38
Table 2. Detailed data for DiphTox PCR colony primers


Note: Both heterodimer energy formation exhibits -5.04 kcal/mol free energy.

For iGEM biobrick submission, we would use prefix and suffix that contain EcoRI and PstI. Further characterization of the biobrick of DiphTox could be accessed via http://parts.igem.org/Part:BBa_K2607000. HindIII site and BamHI are inserted upstream from prefix and downstream from suffix respectively. The DiphTox contains only the last 54 amino acid from the R domain which has no cytotoxicity and significant enough to bind with HBEGF receptor2. At the downstream of the sequence, designing six histidine amino acids is essential for His-tag protein purification, as well as characterizing the DiphTox and HB-EGF/Tar receptor kinetics. Ribosome Binding Site (RBS) is located upstream within the gBlocks containing Shine-Dalgarno sequence as follow.
RBS : 5' GAGCGGATTATATAAGGAGGTTAATC 3’

HB-EGF/Tar
HB-EGF/Tar is a synthetically combined receptor used as project’s diagnostic tool system. Since there was limitation in its biobrick construction (for its high DNA complexity and base pairs length as gBlocks), we separate the HB-EGF/Tar sequence into two fragments called HB-EGF/Tar Fragment 1 (HT-1) in the upstream, and the other one would be HB-EGF/Tar Fragment 2 (HT-2). The schematic structure of HT-1 biobrick is as follow.

Figure 2. HB-EGF/Tar Fragment 1 Biobrick.

The HT-1 fragment consist of 981 bp sequence that include SalI cutting site and specified PCR colony reverse primer (HbT1 rev). Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev), which are the same as cloning primer for DiphTox gBlocks.

For confirmation of this biobrick existence inside E. coli, PCR colony is essential, using specific primers named “PCR colony HbT1 fwd” for forward primer and “PCR colony HbT1 rev” for reverse primer. They are constructed using NCBI primer BLAST website. The sequences are served as follows.

Primers Sequence Melting Temperatures (Tm) GC Content (%) Hairpin Structure Energy Formation (kcal/mol) Self-dimer Energy Formation (kcal/mol)
HbT1 Fwd 5’ CTTACGCTTCTGCCACAT 3’ 61.70C 50% -0.84 -3.61
HbT1 Rev 5’ TTCTTACGCTTCCCATGTTC 3’ 62.10C 45% 0.64 -5.38
Table 3. Detailed data for HT1 PCR colony primers


Note: Both heterodimer energy formations are -4.77 kcal/mol.

Biobrick RFC10 prefix is necessary and would be cut using EcoRI enzyme for submission. Active gene transcription includes highly expressing T7 constitutive promoter (Bba_I712074) located in the upstream part of HT-1. Ribosomal binding site (RBS) (Bba_B0034) functions to initiate direct HB-EGF/Tar translation (HbTf1-RBS). It is 18 bp in length with the following sequence, 5' AAAGAGGAGAAATACTAG 3’, conformed with Shine-Dalgarno sequence
The next fragment of HB-EGF/Tar Sequence, called HB-EGF/Tar Fragment 2 (HT-2), will be ligated exactly next to the first one via SalI restriction site. Schematic representation of HB-EGF/Tar Fragment 2 is as follow.

Figure 3. HB-EGF/Tar Fragment 2 Biobrick.

To amplify this part, we would use universal PCR cloning forward and reverse primers with their sequences same as HT-1 and DiphTox gBlocks. PCR colony, with a specific primer named “HbT2 fwd” for forward primer and “HbT2 Rev” for reverse primer, could be used to confirm any successful transformation of ligated insert. Both primers are constructed with NCBI primer BLAST website and have the sequence detailed below.

Primers Sequence Melting Temperatures (Tm) GC Content (%) Hairpin Structure Energy Formation (kcal/mol) Self-dimer Energy Formation (kcal/mol)
HbT2 Fwd 5’ GTTAGCGGTCTCAGAAATGG 3’ 62.20C 50% -1.15 -3.61
HbT2 Rev 5’ CCCCTGACTGAGCATGAT 3’ 62.80C 55.6% 0.57 -5.38
Table 4. detailed data for HT2 PCR colony primers


Note: Both heterodimer energy formations are -6.73 kcal/mol.

In this fragment, SalI and NdeI are in upstream and downstream respectively. This arrangement would enable that HB-EGF/Tar frag 1 and HB-EGF/Tar frag 2 be next to each other and transcribed as a unity. At the end part of the coding region we add double terminator rrnB T1 and T7TE terminator (Bba_B0015). These terminators have been known to effectively terminate transcription of any gene. We shall submit the overall HB-EGF/Tar biobrick sequence by inserting iGEM registered RFC10 suffix that contain PstI restriction site at the downstream of the coding region. The prefix, as mentioned earlier, is inserted in the first fragment of the HB-EGF/Tar sequence. Further characterization of the biobrick of complete HB-EGF/Tar synthetic gene could be accessed via Further characterization of the biobrick of DiphTox could be accessed via http://parts.igem.org/Part:BBa_K2607001.

Reference
  1. Gillet D, Barbier J. Diphtheria toxin. The Comprehensive Sourcebook of Bacterial Protein Toxins. 2015;:111-132.
  2. 2. Rolf J, Eidels L. Characterization of the diphtheria toxin receptor-binding domain. Molecular Microbiology. 1993;7(4):585-591.
Team UI Indonesia
  igemui2018@gmail.com