Difference between revisions of "Team:METU HS Ankara/Part Collection"

 
(One intermediate revision by one other user not shown)
Line 7: Line 7:
 
                 <div class="col-md-12">
 
                 <div class="col-md-12">
 
                     <h1 class="text-capitalize ct-fw-600 ct-u-colorWhite">
 
                     <h1 class="text-capitalize ct-fw-600 ct-u-colorWhite">
−
                         Basic Parts
+
                         Parts Collection
 
                     </h1>
 
                     </h1>
 
                 </div>
 
                 </div>
Line 17: Line 17:
 
         <div class="container">
 
         <div class="container">
 
             <img src="https://static.igem.org/mediawiki/2018/7/72/T--METU_HS_Ankara--partsbanner.jpg" />
 
             <img src="https://static.igem.org/mediawiki/2018/7/72/T--METU_HS_Ankara--partsbanner.jpg" />
 +
 +
            <p>
 +
                As the METU HS Ankara iGEM 2018 Team, we have submitted five parts for 2018 iGEM competition; two basic and three composite.
 +
                Our basic part 1 includes FucO as the protein coding region and basic 2 includes GSH gene as the protein coding region. FucO
 +
                aims to convert furfural to furfuryl alcohol and GSH aims to impart the overexpression of Glutathione for ultimately increasing
 +
                ethanol yield and lifespan of the ethanologenic <i>E.coli</i> strain KO11. Our Composite part 3 includes both of the coding regions.
 +
                All of our parts are RFC 10 compatible. FucO is obtained from <i>E.coli</i> K12 and GSH is obtained from <i>Streptococcus Thermophilus.</i>
 +
                The table below shows all basic and composite parts submitted to iGEM Registry by our team.
 +
            </p>
 
             <table class="table" style="font-size: 17px">
 
             <table class="table" style="font-size: 17px">
 
                 <thead>
 
                 <thead>
Line 41: Line 50:
 
                     <td>Tugba Inanc & Ceyhun Kayihan</td>
 
                     <td>Tugba Inanc & Ceyhun Kayihan</td>
 
                     <td>2268bp</td>
 
                     <td>2268bp</td>
 +
                </tr>
 +
                <tr class="danger">
 +
                    <td><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571003">BBa_K2571003</a></td>
 +
                    <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td>
 +
                    <td>FucO / L-1,2-propanediol oxidoreductase</td>
 +
                    <td>Tugba Inanc & Ceyhun Kayihan</td>
 +
                    <td>1350bp</td>
 +
                </tr>
 +
                <tr class="warning" style="font-size: 17px">
 +
                    <td><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">BBa_K2571005</a></td>
 +
                    <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td>
 +
                    <td>GSH/ Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase</td>
 +
                    <td>Tugba Inanc & Ceyhun Kayihan</td>
 +
                    <td>2466bp</td>
 +
                </tr>
 +
                <tr class="info">
 +
                    <td><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571006">BBa_K2571006</a></td>
 +
                    <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td>
 +
                    <td>Dual Expression of FucO and GSH</td>
 +
                    <td>Tugba Inanc & Ceyhun Kayihan</td>
 +
                    <td>3644bp</td>
 
                 </tr>
 
                 </tr>
 
                 </tbody>
 
                 </tbody>
 
             </table>
 
             </table>
  
−
             <h3>FucO <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571000">(BBa_K2571000)</a></h3>
+
             <i>Table: All basic and composite parts submitted to iGEM Parts Registry by METU_HS_Ankara 2018 team</i>
−
           
+
−
            <p>
+
−
                FucO is a protein-coding region that codes for L-1,2-propanediol oxidoreductase which is an NADH-linked, homodimer enzyme
+
−
                having the role of acting on furfural. Furfural is a highly toxic substance which inhibits  is a toxic inhibitor of microbial
+
−
                fermentations causing cell wall and membrane damages, DNA breakdowns, DNA cleavages and reduced enzymatic activities
+
−
                (Zheng, 2013; Liu, Ma & Song, 2009).
+
−
            </p>
+
−
 
+
−
            <p>
+
−
                In the presence of furfural, NADPH-dependent oxidoreductases goes active in order to reduce furfural into its less toxic alcohol
+
−
                derivative - furfuryl alcohol (Zheng, 2013; Wang et al., 2013; Allen et al., 2010). In this pathway, the expression of oxidoreductases
+
−
                that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in E. coli by competing with biosynthesis for
+
−
                NADPH (Zheng, 2013).
+
−
            </p>
+
−
 
+
−
            <p>
+
−
                Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions
+
−
                shouldn’t be interfering with NADPH metabolism (Wang et al, 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol
+
−
                oxidoreductase (FucO) gene reduces furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis
+
−
                of NADPH (Wang et al, 2011).
+
−
            </p>
+
−
 
+
−
            <div class="col-md-12 parts-photo-box">
+
−
                <img src="https://static.igem.org/mediawiki/2018/c/c5/T--METU_HS_Ankara--bparts01.jpg" />
+
−
                <br />
+
−
                <i class="parts-info">
+
−
                    Figure 1: <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571000">BBa_K2571000</a>: fucO was cloned into pSB1C3.
+
−
                </i>
+
−
            </div>
+
−
 
+
−
            <div style="clear: both"></div>
+
−
 
+
−
            <div class="col-md-6">
+
−
                <img width="500" src="https://static.igem.org/mediawiki/2018/6/67/T--METU_HS_Ankara--bparts02.jpg" />
+
−
            </div>
+
−
 
+
−
            <div class="col-md-6">
+
−
                <p>
+
−
                    We’ve inserted the gene our FucO, which is our basic part 1,to pSB1C3 backbone and transformed it to DH5- alpha. After plasmid
+
−
                    isolation, we’ve checked the orientation with FucO left and VR primers and expected to see a band of 625 bp.
+
−
                </p>
+
−
            </div>
+
−
 
+
−
            <div style="clear: both"></div>
+
−
 
+
−
            <p>
+
−
                FucO and VR primers are as below:<br>
+
−
                FucO left: GTGATAAGGATGCCGGAGAA<br>
+
−
                VR: ATTACCGCCTTTGAGTGAGC
+
−
            </p>
+
−
 
+
−
            <h3>GSH <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571001">(BBa_K2571001)</a></h3>
+
−
 
+
−
            <p>
+
−
                GSH as is a protein-coding region that codes for Bifunctional gamma glutamate cysteine ligase/ Glutathione synthetase.
+
−
            </p>
+
−
 
+
−
            <p>
+
−
                Glutathione (GSH) is known to be an important antioxidant that is a sulfur compound; a tripeptide composed of three amino acids
+
−
                (cysteine, glycine and glutamic acid) and a non-protein thiol (Pizzorno, 2014; Lu, 2013). GHS is, furthermore, found in thiol-reduced
+
−
                form which accounts for its strength as an antioxidant.
+
−
                   
+
−
            </p>
+
−
 
+
−
            <p>
+
−
                Reactive oxygen species (ROS) are harmful substances that distort protein based matters by taking electrons and also causes oxidative
+
−
                stress (Lu, 2013) which occur during the fermentation process and is another major setback. The chemical structure of the protein-based
+
−
                substances such as the DNA are altered and become therefore become  dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011).
+
−
            </p>
+
−
 
+
−
            <p>
+
−
                GSH is generally found in the thiol-reduced form which is crucial for detoxification of ROS and free radicals. which cause oxidative
+
−
                stress. (Lu, 2013; Burton & Jauniaux, 2011).
+
−
            </p>
+
−
 
+
−
            <p>
+
−
                Antioxidants like GSH play an important role in the detoxification of ROS and reactive oxygen species by directly acting as electron
+
−
                donors;, changing the unbalanced electron state of the free radicals and turningand, turning them into less harmful substances or affect
+
−
                them indirectly by getting in the way of the expression of free radical generating enzymes (Lü et al., 2014).
+
−
            </p>
+
−
 
+
−
            <div class="col-md-12 parts-photo-box">
+
−
                <img src="https://static.igem.org/mediawiki/2018/6/62/T--METU_HS_Ankara--bparts03.jpg" />
+
−
                <br>
+
−
                <i class="parts-info" style="margin-bottom: 20px">
+
−
                    Figure 3:<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571001">BBa_K2571001</a>: GSH was cloned into pSB1C3.
+
−
                </i>
+
−
            </div>
+
−
 
+
−
            <div style="clear: both"></div>
+
−
 
+
−
            <div class="col-md-6" style="margin-bottom: 30px">
+
−
                <img width="500" src="https://static.igem.org/mediawiki/2018/6/6e/T--METU_HS_Ankara--bparts04.jpg" />
+
−
                <br>
+
−
                <i class="parts-info">
+
−
                    Figure 4: BBa_K2571001 check with GSH specific primers. Expected band length: 225 bp. GSH basic well show positive results.
+
−
                </i>
+
−
            </div>
+
−
 
+
−
            <div class="col-md-6">
+
−
                <p>
+
−
                    We’ve inserted the geneour GSH, basic part 2, to pSB1C3 backbone and transformed it to DH5 alpha. After plasmid isolation,
+
−
                    we’ve checked the orientation with GSH specific primers and expected to see a band of 225 bp.
+
−
                </p>
+
−
            </div>
+
−
 
+
−
            <div style="clear: both"></div>
+
−
 
+
−
            <p>
+
−
                GSH left and right primers are shown as below:
+
−
                <br>
+
−
                GSH left: TCGGAGGCTAAAACTCAGGA
+
−
                <br>
+
−
                GSH right: GTGGGCAGTCCAGTCGTAAT
+
−
            </p>
+
−
 
+
−
 
+
−
            <section class="ct-u-paddingTop50 ct-u-paddingBottom80 ct-u-borderBoth ct-u-backgroundGray">
+
−
                <div class="container">
+
−
                    <div class="row">
+
−
                        <div class="col-md-12">
+
−
                            <div class="panel-group" id="accordion">
+
−
                                <div class="panel panel-default">
+
−
                                    <div class="panel-heading">
+
−
                                        <h4 class="panel-title">
+
−
                                            <a data-toggle="collapse" data-parent="#accordion" href="#collapseOne">
+
−
                                                References
+
−
                                            </a>
+
−
                                        </h4>
+
−
                                    </div>
+
−
                                    <div id="collapseOne" class="panel-collapse collapse">
+
−
                                            <ul>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., … Gorsich,
+
−
                                                    S. W.</span> (2010). Furfural induces reactive oxygen species accumulation and cellular damage in
+
−
                                                    Saccharomyces cerevisiae. Biotechnology for Biofuels, 3, 2.
+
−
                                                    <a href="http://doi.org/10.1186/1754-6834-3-2">http://doi.org/10.1186/1754-6834-3-2</a>
+
−
                                                </li>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">Chou, H.-H., Marx, C. J., & Sauer, U.</span> (2015). Transhydrogenase Promotes the Robustness and Evolvability of
+
−
                                                    E. coli Deficient in NADPH Production. PLoS Genetics, 11(2), e1005007.
+
−
                                                    <a href="http://doi.org/10.1371/journal.pgen.1005007">http://doi.org/10.1371/journal.pgen.1005007</a>
+
−
                                                </li>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">Liu, Z.L., Ma M., Song, M.</span>(2009). Evolutionarily engineered ethanologenic yeast detoxifies lignocellulosic
+
−
                                                    biomass conversion inhibitors by reprogrammed pathways. Mol Genet Genomics 282, 233-244. doi:
+
−
                                                    10.1007/s00438-009-0461-7
+
−
                                                </li>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">Wang, X., Miller, E. N., Yomano, L. P., Zhang, X., Shanmugam, K. T., & Ingram, L. O.</span> (2011). Increased
+
−
                                                    Furfural Tolerance Due to Overexpression of NADH-Dependent Oxidoreductase FucO in Escherichia coli Strains
+
−
                                                    Engineered for the Production of Ethanol and Lactate. Applied and Environmental Microbiology, 77(15),
+
−
                                                    5132–5140. <a href="http://doi.org/10.1128/AEM.05008-11">http://doi.org/10.1128/AEM.05008-11</a>
+
−
                                                </li>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">Zheng, H., Wang, X., Yomano, L.P., Geddes, R.D, Shanmugan, K. T., Ingram, L.O.</span> (2013). Improving
+
−
                                                    Escherichia coli FucO for Furfural Tolerance by Saturation Mutagenesis of Individual Amino Acid Positions.
+
−
                                                    Applied and Environmental Microbiology Vol 79, no 10. 3202–3208.
+
−
                                                    <a href="http://aem.asm.org/content/79/10/3202.full.pdf+html">http://aem.asm.org/content/79/10/3202.full.pdf+html</a>
+
−
                                                </li>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">Lu, S. C.</span> (2013). Glutathione Synthesis. Biochemical et Biophysica Acta, 1830(5), 3143–3153.
+
−
                                                    <a href="http://doi.org/10.1016/j.bbagen.2012.09.008">http://doi.org/10.1016/j.bbagen.2012.09.008</a>
+
−
                                                </li>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">National Center for Biotechnology Information.</span> PubChem Compound Database; CID=124886,
+
−
                                                    <a href="https://pubchem.ncbi.nlm.nih.gov/compound/124886">https://pubchem.ncbi.nlm.nih.gov/compound/124886</a> (accessed July 18, 2018).
+
−
                                                    <a href="https://pubchem.ncbi.nlm.nih.gov/compound/124886#section=Top">https://pubchem.ncbi.nlm.nih.gov/compound/124886#section=Top</a>
+
−
                                                </li>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">Pizzorno, J.</span> (2014). Glutathione! Integrative Medicine: A Clinician’s Journal, 13(1), 8–12.
+
−
                                                    <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/">https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/</a>
+
−
                                                </li>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">Burton, G. J., & Jauniaux, E.</span> (2011). Oxidative stress. Best Practice & Research. Clinical Obstetrics &
+
−
                                                    Gynaecology, 25(3), 287–299.
+
−
                                                    <a href="http://doi.org/10.1016/j.bpobgyn.2010.10.016">http://doi.org/10.1016/j.bpobgyn.2010.10.016</a>
+
−
                                                </li>
+
−
                                                <li>
+
−
                                                    <span style="font-weight:bold">Lü, J.-M., Lin, P. H., Yao, Q., & Chen, C.</span> (2010). Chemical and molecular mechanisms of antioxidants:
+
−
                                                    experimental approaches and model systems. Journal of Cellular and Molecular Medicine, 14(4), 840–860.
+
−
                                                    <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/">http://doi.org/10.1111/j.1582-4934.2009.00897.x</a>
+
−
                                                </li>
+
−
                                            </ul>
+
−
                                           
+
−
                                    </div>
+
−
                                </div>
+
−
                            </div>
+
−
                        </div>
+
−
                    </div>
+
−
                </div>
+
−
            </section>
+
  
 
         </div>
 
         </div>

Latest revision as of 12:52, 17 October 2018

METU HS IGEM

METUHSIGEM_LOGO

Parts Collection

As the METU HS Ankara iGEM 2018 Team, we have submitted five parts for 2018 iGEM competition; two basic and three composite. Our basic part 1 includes FucO as the protein coding region and basic 2 includes GSH gene as the protein coding region. FucO aims to convert furfural to furfuryl alcohol and GSH aims to impart the overexpression of Glutathione for ultimately increasing ethanol yield and lifespan of the ethanologenic E.coli strain KO11. Our Composite part 3 includes both of the coding regions. All of our parts are RFC 10 compatible. FucO is obtained from E.coli K12 and GSH is obtained from Streptococcus Thermophilus. The table below shows all basic and composite parts submitted to iGEM Registry by our team.

Name Type Description Designer Length
BBa_K2571000 FucO /L-1,2-propanediol oxidoreductase Tugba Inanc & Ceyhun Kayihan 1152bp
BBa_K2571001 Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase Tugba Inanc & Ceyhun Kayihan 2268bp
BBa_K2571003 FucO / L-1,2-propanediol oxidoreductase Tugba Inanc & Ceyhun Kayihan 1350bp
BBa_K2571005 GSH/ Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase Tugba Inanc & Ceyhun Kayihan 2466bp
BBa_K2571006 Dual Expression of FucO and GSH Tugba Inanc & Ceyhun Kayihan 3644bp
Table: All basic and composite parts submitted to iGEM Parts Registry by METU_HS_Ankara 2018 team