Difference between revisions of "Team:METU HS Ankara/Composite Part"

 
(59 intermediate revisions by 4 users not shown)
Line 14: Line 14:
 
     </header>
 
     </header>
  
     <section class="ct-u-paddingBoth100">
+
     <section class="ct-u-paddingBoth50">
 
         <div class="container">
 
         <div class="container">
 +
            <img src="https://static.igem.org/mediawiki/2018/7/72/T--METU_HS_Ankara--partsbanner.jpg" />
 
             <table class="table" style="font-size: 17px">
 
             <table class="table" style="font-size: 17px">
 
                 <thead>
 
                 <thead>
Line 28: Line 29:
 
                 <tbody>
 
                 <tbody>
 
                 <tr class="danger">
 
                 <tr class="danger">
                     <td><a href="">BBa_K2571003</a></td>
+
                     <td><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571003">BBa_K2571003</a></td>
                     <td><img src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td>
+
                     <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td>
                     <td>FucO / L-1,2-propanediol oxidoreductase fucO</td>
+
                     <td>FucO / L-1,2-propanediol oxidoreductase</td>
                     <td>Tuğba İnanç & Ceyhun Kayıhan</td>
+
                     <td>Tugba Inanc & Ceyhun Kayihan</td>
                     <td>1350bp</td>
+
                     <td>1350 bp</td>
 
                 </tr>
 
                 </tr>
                 <tr class="warning" style="font-size: 17px">
+
                 <tr class="warning" style="font-size: 17px; color: #000000">
                     <td><a href="">BBa_K2571005</a></td>
+
                     <td><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">BBa_K2571005</a></td>
                     <td><img src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td>
+
                     <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td>
                     <td>GSH/ Bifunctional gamma-glutamate-cysteine ligase/glutathione synthetase</td>
+
                     <td>GSH/ Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase</td>
                     <td>Tuğba İnanç & Ceyhun Kayıhan</td>
+
                     <td>Tugba Inanc & Ceyhun Kayihan</td>
                     <td>2466bp</td>
+
                     <td>2466 bp</td>
 
                 </tr>
 
                 </tr>
 
                 <tr class="info">
 
                 <tr class="info">
                     <td><a href="">BBa_K2571006</a></td>
+
                     <td><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571006">BBa_K2571006</a></td>
                     <td><img src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td>
+
                     <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td>
 
                     <td>Dual Expression of FucO and GSH</td>
 
                     <td>Dual Expression of FucO and GSH</td>
                     <td>Tuğba İnanç & Ceyhun Kayıhan</td>
+
                     <td>Tugba Inanc & Ceyhun Kayihan</td>
                     <td>3644bp</td>
+
                     <td>3644 bp</td>
 
                 </tr>
 
                 </tr>
 
                 </tbody>
 
                 </tbody>
Line 54: Line 55:
 
             <h4>FucO/ L-1,2-Propanediol Oxidoreductase</h4>
 
             <h4>FucO/ L-1,2-Propanediol Oxidoreductase</h4>
 
             <p>
 
             <p>
                 FucO is the gene that codes for L-1,2-propanediol oxidoreductase which is a NADH-linked, homodimer enzyme having the role  
+
                 FucO is the gene that codes for L-1,2-propanediol oxidoreductase which is a NADH-linked, homodimer enzyme having the role of
                 of acting on furfural which is a toxic inhibitor of microbial fermentations causing cell wall and membrane damage, DNA breaks
+
                 acting on furfural which is a toxic inhibitor of microbial fermentations causing cell wall and membrane damage, DNA breakdowns
                 down and reduced enzymatic activities (Zheng, 2013; Liu, Ma & Song, 2009).
+
                 and reduced enzymatic activities (Zheng, 2013; Liu, Ma & Song, 2009).
 
             </p>
 
             </p>
  
 
             <p>
 
             <p>
 
                 The enzyme catalyzes L-lactaldehyde and L-1,2- propanediol while dissimilating fucose in which acetaldehyde, ethylene glycerol,  
 
                 The enzyme catalyzes L-lactaldehyde and L-1,2- propanediol while dissimilating fucose in which acetaldehyde, ethylene glycerol,  
                 L-lactaldehyde and some more substances are used as substrates. Despite these, it takes an important role in furan reduction to
+
                 L-lactaldehyde and some more substances are used as substrates. Despite these, it takes an important role in furan reduction  
                 its alcohol derivative (Wang et al., 2011).
+
                 to its alcohol derivative (Wang <i>et al.</i>, 2011).
 
             </p>
 
             </p>
 +
 +
            <img src="https://static.igem.org/mediawiki/2018/7/70/T--METU_HS_Ankara--cparts06.jpg" />
  
 
             <h5>Our circuit design for FucO gene</h5>
 
             <h5>Our circuit design for FucO gene</h5>
 
             <p>
 
             <p>
 
                 Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), FucO as protein coding region, double terminator (B0015)  
 
                 Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), FucO as protein coding region, double terminator (B0015)  
                 and suffix. This part enables our E. coli KO11 strain to convert toxic furfural into furfuryl alcohol. Our construct is inserted  
+
                 and suffix. This part enables our <i>E. coli</i> KO11 strain to convert toxic furfural into furfuryl alcohol. Our construct was inserted  
 
                 into pSB1C3 and delivered to the Registry.
 
                 into pSB1C3 and delivered to the Registry.
 
             </p>
 
             </p>
  
 
             <img src="https://static.igem.org/mediawiki/2018/0/03/T--METU_HS_Ankara--cparts02.jpg" />
 
             <img src="https://static.igem.org/mediawiki/2018/0/03/T--METU_HS_Ankara--cparts02.jpg" />
 +
            <br />
 +
            <i class="parts-info">
 +
                Figure 1: Circuit design of Composite part 1 with FucO gene. <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571003">BBa_K2571003.</a>
 +
                Our construct includes a strong promoter,  RBS, FucO and double terminator.
 +
            </i>
  
 
             <p>
 
             <p>
                FucO has NADH-dependent furan reductase activity. When furfural is present in the field, the metabolism of furfural by NADPH-dependent
+
                    In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting
                oxidoreductases go active in order to reduce it to its less toxic alcohol derivative-furfuryl alcohol (Zheng, 2013; Wang et al., 2013;
+
                    the amino acid sequence. We looked through the codon bias property of <i>E. coli</i> and made the nucleotide changes accordingly.  
                Allen et al., 2010).
+
 
             </p>
 
             </p>
  
             <img src="https://static.igem.org/mediawiki/2018/1/10/T--METU_HS_Ankara--cparts03.jpg" />
+
            <p>
 +
                FucO has NADH-dependent furan reductase activity. When furfural is present in the field, the metabolism of furfural by NADPH-dependent oxidoreductases
 +
                goes active in order to reduce it to its less toxic alcohol derivative-furfuryl alcohol (Zheng, 2013; Wang <i>et al.</i>, 2013; Allen <i>et al.</i>, 2010).
 +
            </p>
 +
             <img src="https://static.igem.org/mediawiki/2018/0/0c/T--METU_HS_Ankara--cparts0121566415.jpg" />
 +
            <br>
 +
            <i class="parts-info">
 +
                Figure 2: Effect of FucO overexpression in LY180 (Wang <i>et al.</i>, 2011). The cell mass was observed in furfural containing medium. The FucO gene expressing
 +
                L-1,2-propanediol oxidoreductase reduces the effect of furfural. The specific death rate of normal bacteria is observed to be higher than the specific
 +
                death rate of bacteria with FucO gene. Thus, FucO is shown to increase the tolerance and lifespan of bacteria.
 +
            </i>
  
 
             <p>
 
             <p>
                 In this metabolism, the expression of oxidoreductases that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and  
+
                 In this metabolism, the expression of oxidoreductases that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in <i>E. coli</i>
                fermentation in E. coli by competing for biosynthesis with NADPH (Zheng, 2013).
+
                by competing for biosynthesis with NADPH (Zheng, 2013).
 
             </p>
 
             </p>
  
 
             <img src="https://static.igem.org/mediawiki/2018/9/9d/T--METU_HS_Ankara--cparts04.jpg" />
 
             <img src="https://static.igem.org/mediawiki/2018/9/9d/T--METU_HS_Ankara--cparts04.jpg" />
 +
            <br>
 +
            <i class="parts-info">
 +
                Figure 3: The overexpression of FucO and YqhD and relationships with furfural resistance traits, metabolism, and reducing cofactors (Wang <i>et al.</i>, 2013).
 +
            </i>
  
 
             <p>
 
             <p>
                 Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions  
+
                 Because the native conversion of NADH to NADPH in <i>E. coli</i> is insufficient to revitalize the NADPH pool during fermentation, the actions shouldn’t be  
                shouldn’t be interfering with NADPH metabolism (Wang et al., 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol  
+
                interfering with NADPH metabolism (Wang <i>et al.</i>, 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol oxidoreductase (FucO) gene  
                oxidoreductase (FucO) gene may reduce furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis  
+
                reduces furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis of NADPH (Wang <i>et al.</i>, 2011).
                of NADPH (Wang et al., 2011).
+
 
             </p>
 
             </p>
  
             <p>
+
             <img width="500" src="https://static.igem.org/mediawiki/2018/b/be/T--METU_HS_Ankara--cparts05.gif" />
                 Figure 2: The overexpression of FucO and YqhD and relationships with furfural resistance traits, metabolism, and reducing cofactors
+
            <br>
                (Wang et al., 2013).
+
            <i class="parts-info" style="margin-bottom: 20px">
             </p>
+
                 Figure 4: 3D protein structure of L-1,2-propanediol oxidoreductase.
 +
             </i>
  
 
             <p>
 
             <p>
                 In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites
+
                 The protein structure of L-1,2-propanediol oxidoreductase was constructed by using Amber 14. It is demonstrated in ribbon diagram which is done by interpolating a smooth curve through the polypeptide backbone. The colors indicate the amino acids in the protein structure.
                while protecting the amino acid sequence. We looked through the codon bias property of E. coli and made the nucleotide changes accordingly.
+
 
             </p>
 
             </p>
 +
 +
            <div class="col-md-6" style="margin-bottom: 30px">
 +
                <img width="500" src="https://static.igem.org/mediawiki/2018/f/f1/T--METU_HS_Ankara--cparts07.jpg" />
 +
                <br>
 +
                <i class="parts-info" style="line-height: 0px !important">
 +
                    Figure 5: BBa_K2571003 check with FucO left and VR primers. Expected band length: 754 bp. Last three wells show positive results.
 +
                </i>
 +
            </div>
 +
 +
            <div class="col-md-6">
 +
                <p>
 +
                    We’ve inserted the FucO composite part to pSB1C3 and pSB1A3 backbones. Then, we’ve transformed the construct for submission,
 +
                    <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571003">BBa_K2571003</a>, (in pSB1C3)
 +
                    to DH5⍺; and the other construct, for our biochemical assay, (in pSB1A3) to KO11. As we isolated the plasmids, we’ve done PCR with FucO left and VR
 +
                    primers to test orientation of our parts to the backbone. We expected a band of 754 bp between the FucO left and VR primers and the PCR results confirmed
 +
                    our expectations and showed that our parts were correctly inserted and transformed.
 +
                </p>
 +
            </div>
 +
 +
            <div style="clear: both"></div>
  
 
             <p>
 
             <p>
                 We’ve inserted the FucO composite part to pSB1C3 and pSB1A3 backbones. Then, we’ve transformed the construct for submission, BBa_K2571003,
+
                 FucO Left and VR primers are as below:
                 (in pSB1C3) to Dh4 alpha; and the other construct, for our biochemical assay,  (in pSB1A3) to KO11. As we isolated the plasmids, we’ve done
+
                 <br >
                 PCR with FucO left and VR primers to test orientation of our parts to the backbone. We expected a band of 754 bp between the FucO left and
+
                 FucO Left: GTGATAAGGATGCCGGAGAA
                 VR primers and the PCR results confirmed our expectations and showed that our parts were correctly inserted and transformed.
+
                <br >
 +
                 VR: ATTACCGCCTTTGAGTGAGC
 +
                   
 
             </p>
 
             </p>
  
 
             <h3>Composite 2:</h3>
 
             <h3>Composite 2:</h3>
             <h4>GSH:Bifunctional gamma-glutamate-cysteine ligase/glutathione synthetase</h4>
+
             <h4>GSH:Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase</h4>
  
 
             <p>
 
             <p>
                 Glutathione (GSH) is an important antioxidant that has a sulfur compound; a tripeptide composed of three amino acids (cysteine, glycine
+
                 Reactive Oxygen Species (ROS) are dangerous substances that distort protein based matters by taking electrons (Lu, 2013). The chemical structure of the protein-based
                and glutamic acid) and a non-protein thiol (Pizzorno, 2014; Lu, 2013). GSH is generally found in the thiol-reduced from which is crucial
+
                 substances are altered and become dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011).
                 for detoxification of ROS and free radicals which cause oxidative stress (Lu, 2013; Burton & Jauniaux, 2011).
+
 
             </p>
 
             </p>
  
 
             <p>
 
             <p>
                 Reactive Oxygen Species are dangerous substances that distort protein based matters by taking electrons (Lu, 2013). The chemical structure
+
                 Furthermore; one of the most significant protein-based substance, DNA, gets attacked by OH radicals (Burton & Jauniaux, 2011). However, the reduced form GSH can protect
                 of the protein-based substances are altered and become dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011).  
+
                 the chemical structure of the proteins by donating extra electrons to ROS and free radicals (Lu, 2013). This is accomplished by GSH peroxidase-catalyzed reactions
 +
                (Lu, 2013).
 
             </p>
 
             </p>
 +
 +
            <img src="https://static.igem.org/mediawiki/2018/7/70/T--METU_HS_Ankara--cparts0121566.jpg" />
 +
 +
            <img width="500" src="https://static.igem.org/mediawiki/2018/c/cd/T--METU_HS_Ankara--cparts08.gif" />
 +
            <br>
 +
            <i class="parts-info">
 +
                Figure 6: 3D protein structure of Bifunctional gamma-glutamate-cysteine ligase.
 +
            </i>
  
 
             <p>
 
             <p>
                 Furthermore, one of the most significant protein-based substance, DNA get attacked by OH radicals (Burton & Jauniaux, 2011). However,
+
                 The protein structure of Bifunctional gamma-glutamate-cysteine ligase was constructed by using Amber 14. It is demonstrated in ribbon diagram which is done by interpolating a smooth curve through the polypeptide backbone. The colors indicate the amino acids in the protein structure.
                the reduced form GSH can protect the chemical structure of the proteins by giving extra electrons to the ROS and free radicals (Lu, 2013).
+
                This is accomplished by GSH peroxidase-catalyzed reactions (Lu, 2013).
+
 
             </p>
 
             </p>
 +
 +
            <h5>Our circuit design for GSH gene</h5>
  
 
             <p>
 
             <p>
                 In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while
+
                 Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), GSH as protein coding region, double terminator (B0015) and suffix. This part enables our <i>E. coli</i> KO11 strain to overexpress oxidised Glutathione to reduce oxidative stress, increasing its lifespan (Lu, 2013). Our construct was inserted into pSB1C3 and  
                protecting the amino acid sequence. We looked through the codon bias property of E.coli and made the nucleotide changes accordingly.
+
                delivered to the Registry.
 
             </p>
 
             </p>
  
             <h5>Our circuit design for GSH gene</h5>
+
             <img src="https://static.igem.org/mediawiki/2018/b/b4/T--METU_HS_Ankara--cparts09.jpg" />
 +
            <br>
 +
            <i class="parts-info">
 +
                Figure 7: Circuit design of Composite part 2 with GSH gene. <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">BBa_K2571005</a>. Our construct
 +
                includes a strong promoter,  RBS, GSH and double terminator.
 +
            </i>
  
 
             <p>
 
             <p>
                 Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), GSH as  A protein coding region, double terminator (B0015) and
+
                 In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting the amino acid
                 suffix. This part enables our E. coli KO11 strain to overexpress Oxidised Glutathione to reduce oxidative stress, increasing its lifespan.
+
                 sequence. We looked through the codon bias property of <i>E. coli</i> and made the nucleotide changes accordingly.  
                (Lu, 2013) Our construct is inserted into pSB1C3 and delivered to the Registry.
+
 
             </p>
 
             </p>
  
             <span class="ct-blockquote-text ct-fs-i ct-fw-300 ct-u-arapey">Composite 2 (GSH) PCR Results With The Primers GSH Left and GSH Right:</span>
+
             <img src="https://static.igem.org/mediawiki/2018/8/87/T--METU_HS_Ankara--cparts012566.jpg" />
 +
            <br>
 +
            <i class="parts-info">
 +
                Figure 8: Because Glutathione prevents ROS from harming the bacteria, increase in cell mas was observed in high concentrations of Glutathione. In brief, when
 +
                Glutathione concentration increases, the specific cell growth rate also increases and we observe an increase in the number of bacteria compared to the bacteria without
 +
                the GSH gene (Kim & Hahn , 2013). 
 +
            </i>
 +
 
 +
            <div class="col-md-6">
 +
                <img src="https://static.igem.org/mediawiki/2018/9/9d/T--METU_HS_Ankara--cparts01256eeie6.jpg" />
 +
                <br>
 +
                <i class="parts-info">
 +
                    Figure 9: <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">BBa_K2571005</a> check with GSH specific  primers. Expected band length: 225 bp.
 +
                    Last six wells show positive results. 
 +
                </i>
 +
            </div>
 +
 
 +
            <div class="col-md-6">
 +
                <p>
 +
                    We’ve inserted the GSH composite part to pSB1C3 backbone. Then, we’ve transformed the construct for submission,
 +
                    <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">BBa_K2571005</a>, (in pSB1C3)  
 +
                    to Dh4 alpha and conducted colony PCR. We’ve prepared the PCR with GSH specific primers and expected to see a result of 225 bp. By showing the
 +
                    band we expected, 225 bp, PCR confirmation for our insertion proved right.
 +
                </p>
 +
            </div>
  
 +
            <div style="clear: both"></div>
 
             <p>
 
             <p>
                 We’ve inserted the GSH composite part to pSB1C3 backbone. Then, we’ve transformed the construct for submission,
+
                 GSH left and right primers are shown as below:
                 <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">BBa_K2571005</a>, (in pSB1C3)
+
                 <br >
                 to Dh4 alpha and conducted colony PCR. We’ve made the PCR with GSH specific primers and expected to see a result of 225bp. By showing the
+
                 GSH left: TCGGAGGCTAAAACTCAGGA
                 band we expected, 225bp, PCR confirmation for our insertion proved right.
+
                 <br >
 +
                GSH right: GTGGGCAGTCCAGTCGTAAT
 
             </p>
 
             </p>
  
Line 161: Line 241:
 
                 The first protein coding region we have, placed after the RBS, FucO, will code for L-1,2-propanediol oxidoreductase (a homodimer enzyme)  
 
                 The first protein coding region we have, placed after the RBS, FucO, will code for L-1,2-propanediol oxidoreductase (a homodimer enzyme)  
 
                 in order to act upon furfural presence in the field (Zheng, 2013). The metabolism of furfural by NAD(P)H-dependent oxidoreductases will  
 
                 in order to act upon furfural presence in the field (Zheng, 2013). The metabolism of furfural by NAD(P)H-dependent oxidoreductases will  
                 reduce the toxicity of the chemical by turning it into furfuryl alcohol, a derivative and increase the furfural tolerance (Zheng, 2013;  
+
                 reduce the toxicity of the chemical by turning it into a derivative, furfuryl alcohol, and increase the furfural tolerance (Zheng, 2013;  
                 Wang et al., 2013; Allen et al., 2010). Our second protein coding region, bifunctional gamma-glutamate-cysteine ligase/glutathione
+
                 Wang <i>et al.</i>, 2013; Allen <i>et al.</i>, 2010). Our second protein coding region, bifunctional gamma-glutamate-cysteine ligase/Glutathione
 
                 synthetase (GSH), is a non-protein thiol group and a tripeptide composed of cysteine, glycine and glutamic acid (Lu, 2013). It is crucial  
 
                 synthetase (GSH), is a non-protein thiol group and a tripeptide composed of cysteine, glycine and glutamic acid (Lu, 2013). It is crucial  
                 for the detoxification of reactive oxygen species and free radicals (Ask et al, 2013). Reactive oxygen species (ROS) are harmful substances  
+
                 for the detoxification of reactive oxygen species and free radicals (Ask <i>et al.</i> 2013). Reactive oxygen species (ROS) are harmful substances  
 
                 that alter protein based matters by taking electrons (Lu, 2013; Burton & Jauniaux, 2011). Because many benefits of GSH include scavenging  
 
                 that alter protein based matters by taking electrons (Lu, 2013; Burton & Jauniaux, 2011). Because many benefits of GSH include scavenging  
                 of ROS, protection against endogenous toxic metabolites and detoxification of xenobiotics, we choose this gene to entagrate with the FucO  
+
                 of ROS, protection against endogenous toxic metabolites and detoxification of xenobiotics, we choose this gene to integrate with FucO  
                 (Höck et al., 2013). Thus we constructed multi functional gene providing long life span and resistance.
+
                 (Höck <i>et al.</i>, 2013). Thus we constructed a multi-functional gene providing long life span and resistance.
 
             </p>
 
             </p>
  
             <h4>Design Notes of Dual Expression of FucO and GSH</h4>
+
             <h4>Design Notes of Dual Expression of FucO and GSH <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571006">(BBa_K2571006)</a></h4>
  
 
             <p>
 
             <p>
                 Our construct for composite part 3 is composed of two stages, first the reduction of furans (specifically furfural and 5-HMF) and second  
+
                 Our construct for composite part 3 is composed of two stages, first the reduction of furans (specifically furfural and 5-HMF) and second the
                 the detoxification of reactive oxygen species (ROS). Our first composite part, fucO gene coding for L-1,2-propanediol oxidoreductase along
+
                 detoxification of reactive oxygen species (ROS). To achieve this effect, we designed our composite 3 part as with a prefix, a strong promoter
                 with the promoter J23100, RBS B0034 and double terminator B0034, is NADH-dependent, which highly benefits to the construct of our project.  
+
                 (J23100), RBS (B0034), FucO as the first protein coding region <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571003">(BBa_K2571003)</a>,  
                 Our construct is inserted into pSB1C3 and delivered to the Registry.
+
                RBS (B0034), GSH as the second protein coding region <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">(BBa_K2571005)</a>,
 +
                 double terminator (B0015) and suffix.
 
             </p>
 
             </p>
 +
 +
            <img src="https://static.igem.org/mediawiki/2018/d/dc/T--METU_HS_Ankara--cparts01256eie6.jpg" />
 +
            <br>
 +
            <i class="parts-info">
 +
                Figure 10: Circuit design of Composite part 3 with FucO and GSH genes. <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571006">BBa_K2571006</a>.
 +
                Our construct includes a strong promoter, RBS, FucO, RBS, GSH and double terminator.
 +
            </i>
  
 
             <p>
 
             <p>
                 As fucO is NADH-dependent it outperforms other oxidoreductases, by not interfering with the NADPH metabolism of the organism while converting
+
                 Our construct was inserted into pSB1C3 and delivered to the Registry. Our construct was also inserted into pSB1A3 and transferred into KO11 to  
                highly toxic substances, furfural and 5-HMF to non-harmful alcohols. This characteristic of fucO is crucial because the expression of
+
                 conduct further biochemical assays.  
                 oxidoreductases like Yqhd are NADPH-dependent, hence they compete with the biosynthesis for NADPH, which results in inhibiting the growth of
+
                the organism.
+
 
             </p>
 
             </p>
  
             <section class="ct-u-paddingTop50 ct-u-paddingBottom80 ct-u-borderBoth ct-u-backgroundGray">
+
             <p>
 +
                Given that FucO is NADH-dependent, it outperforms other oxidoreductases by not interfering with the NADPH metabolism of the organism while converting highly
 +
                toxic substances, furfural and 5-HMF to non-harmful alcohols. This characteristic of FucO is crucial because the expression of oxidoreductases like Yqhd are
 +
                NADPH-dependent, hence they compete with the biosynthesis for NADPH, which results in inhibiting the growth of the organism.
 +
            </p>
 +
 
 +
            <p>
 +
                Glutathione, on the other hand, is recycled using NAD(P)H pathways and since its over-expression with NADH metabolism not being altered thanks
 +
                to FucO, antioxidant capacity of the cell will be increased dramatically; resulting in amplified immunity to both furans and ROS, habilitated cell growth and
 +
                increased ethanol yield by the virtue of increasing cell mass and reproduction, and improved metabolism.
 +
            </p>
 +
 
 +
            <h3>Gel Results</h3>
 +
 
 +
            <img src="https://static.igem.org/mediawiki/2018/4/45/T--METU_HS_Ankara--res10.jpg" />
 +
            <i class="parts-info">
 +
                Figure 11: BBa_K2571006 check with GSH and FucO specific  primers. Expected band length: 194 bp. Green boxes show positive results.
 +
            </i>
 +
 
 +
            <p>
 +
                We’ve inserted our composite part 3(BBa_K2571006) in both pSB1C3 and pSB1A3 backbones. The construct in pSB1C3 is for submission to registry and is  cultivated
 +
                in DH5 alpha. The plasmid having pSB1A3 as backbone, thus carrying ampicillin resistance is for our biochemical assays since we’ve chosen the chassis organism
 +
                for assays as E.coli strain KO11 which already has Chloramphenicol resistance in its genome.  After cloning our genes, we’ve made colony PCR to verify our insertions.
 +
                We chose the primers as FucO specific since the composite 3 contains FucO coding region. Expected band length was 194 bp, and as expected, the bands were given by all
 +
                of the DH5 alpha and KO11 colonies we chose, confirming our transformations.
 +
            </p>
 +
 
 +
            <p>
 +
                FucO specific primers were used:<br>
 +
                FucO left: GTGATAAGGATGCCGGAGAA<br>
 +
                FucO right: CTTCTCGCCGGTAAAGTCAG<br>
 +
            </p>
 +
 
 +
 
 
                 <div class="container">
 
                 <div class="container">
 
                     <div class="row">
 
                     <div class="row">
Line 201: Line 320:
 
                                     <div id="collapseOne" class="panel-collapse collapse">
 
                                     <div id="collapseOne" class="panel-collapse collapse">
 
                                         <div class="panel-body">
 
                                         <div class="panel-body">
                                             Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., Gorsich, S. W. (2010).  
+
                                             <ul>
                                            Furfural induces reactive oxygen species accumulation and cellular damage in Saccharomyces cerevisiae.  
+
                                                <li>
                                            Biotechnology for Biofuels, 3, 2. http://doi.org/10.1186/1754-6834-3-2
+
                                                    <strong>Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., Gorsich, S. W.</strong>
 +
                                                    (2010). Furfural induces reactive oxygen species accumulation and cellular damage in Saccharomyces cerevisiae. Biotechnology for Biofuels, 3, 2.
 +
                                                    <a href="http://doi.org/10.1186/1754-6834-3-2">http://doi.org/10.1186/1754-6834-3-2</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Burton, G. J., & Jauniaux, E.</strong>
 +
                                                    (2011). Oxidative stress. Best Practice & Research. Clinical Obstetrics & Gynaecology, 25(3), 287–299.
 +
                                                    <a href="http://doi.org/10.1016/j.bpobgyn.2010.10.016">http://doi.org/10.1016/j.bpobgyn.2010.10.016</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Chou, H.-H., Marx, C. J., & Sauer, U.</strong>
 +
                                                    (2015). Transhydrogenase Promotes the Robustness and Evolvability of E. coli Deficient in NADPH Production. PLoS Genetics, 11(2), e1005007.
 +
                                                    <a href="http://doi.org/10.1371/journal.pgen.1005007">http://doi.org/10.1371/journal.pgen.1005007</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Lu, S. C.</strong>
 +
                                                    (2013). Glutathione Synthesis. Biochemica et Biophysica Acta, 1830(5), 3143–3153.
 +
                                                    <a href="http://doi.org/10.1016/j.bbagen.2012.09.008">http://doi.org/10.1016/j.bbagen.2012.09.008</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Liu, Z.L., Ma M., Song, M.</strong>
 +
                                                    (2009). Evolutionarily engineered ethanologenic yeast detoxifies lignocellulosic biomass conversion inhibitors by reprogrammed pathways. Mol Genet Genomics 282, 233-244.
 +
                                                    <a href="http://doi.org/10.1007/s00438-009-0461-7">http://doi.org/10.1007/s00438-009-0461-7</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>National Center for Biotechnology Information.</strong>
 +
                                                    PubChem Compound Database; CID=124886,
 +
                                                    <a href="https://pubchem.ncbi.nlm.nih.gov/compound/124886">https://pubchem.ncbi.nlm.nih.gov/compound/124886</a>
 +
                                                    (accessed July 18, 2018).
 +
                                                    <a href="https://pubchem.ncbi.nlm.nih.gov/compound/124886#section=Top">https://pubchem.ncbi.nlm.nih.gov/compound/124886#section=Top</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Pizzorno, J.</strong>
 +
                                                    (2014). Glutathione! Integrative Medicine: A Clinician’s Journal, 13(1), 8–12.
 +
                                                    <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/">https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Wang, X., Miller, E. N., Yomano, L. P., Zhang, X., Shanmugam, K. T., & Ingram, L. O.</strong>
 +
                                                    (2011). Increased Furfural Tolerance Due to Overexpression of NADH-Dependent Oxidoreductase FucO in Escherichia coli Strains Engineered
 +
                                                    for the Production of Ethanol and Lactate. Applied and Environmental Microbiology, 77(15), 5132–5140.
 +
                                                    <a href="http://doi.org/10.1128/AEM.05008-11">http://doi.org/10.1128/AEM.05008-11</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Wang, X & N Miller, E & Yomano, Lorraine & Zhang, Xueli & T Shanmugam, K & Ingram, Lonnie.</strong>
 +
                                                    ((2011). Increased Furfural Tolerance Due to Overexpression of NADH-Dependent Oxidoreductase FucO in Escherichia coli Strains Engineered
 +
                                                    for the Production of Ethanol and Lactate. Applied and environmental microbiology.
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Xuan Wang, Lorraine P. Yomano, James Y. Lee, Sean W. York, Huabao Zheng,Michael T. Mullinnix, K. T. Shanmugam, and Lonnie O. Ingram,</strong>
 +
                                                    (2013), Engineering furfural tolerance in Escherichia coli improves the fermentation of lignocellulosic sugars into renewable chemicals.
 +
                                                    <a href="https://doi.org/10.1073/pnas.1217958110">https://doi.org/10.1073/pnas.1217958110</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Zheng, H., Wang, X., Yomano, L.P., Geddes, R. D, Shanmugan, K. T., Ingram, L.O.</strong>
 +
                                                    (2013). Improving Escherichia coli FucO for Furfural Tolerance by Saturation Mutagenesis of Individual Amino Acid Positions.
 +
                                                    Applied and Environmental Microbiology Vol 79, no 10.3202–3208.
 +
                                                    <a href="http://aem.asm.org/content/79/10/3202.full.pdf+html">http://aem.asm.org/content/79/10/3202.full.pdf+html</a>
 +
                                                </li>
 +
                                                <li>
 +
                                                    <strong>Kim, D., & Hahn, J.-S.</strong>
 +
                                                    (2013). Roles of the Yap1 Transcription Factor and Antioxidants in Saccharomyces cerevisiae’s Tolerance to Furfural and 5-Hydroxymethylfurfural,
 +
                                                    Which Function as Thiol-Reactive Electrophiles Generating Oxidative Stress. Applied and Environmental Microbiology, 79(16), 5069–5077.
 +
                                                    <a href="http://doi.org/10.1128/AEM.00643-13">http://doi.org/10.1128/AEM.00643-13</a>
 +
                                                </li>
 +
                                            </ul>
 +
                                           
 
                                         </div>
 
                                         </div>
 
                                     </div>
 
                                     </div>
Line 214: Line 398:
  
 
         </div>
 
         </div>
    </section>
 
  
 
</html>
 
</html>
  
 
{{METU_HS_Ankara/footer}}
 
{{METU_HS_Ankara/footer}}

Latest revision as of 15:13, 17 October 2018

METU HS IGEM

METUHSIGEM_LOGO

Composite Parts

Name Type Description Designer Length
BBa_K2571003 FucO / L-1,2-propanediol oxidoreductase Tugba Inanc & Ceyhun Kayihan 1350 bp
BBa_K2571005 GSH/ Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase Tugba Inanc & Ceyhun Kayihan 2466 bp
BBa_K2571006 Dual Expression of FucO and GSH Tugba Inanc & Ceyhun Kayihan 3644 bp

Composite Part 1:

FucO/ L-1,2-Propanediol Oxidoreductase

FucO is the gene that codes for L-1,2-propanediol oxidoreductase which is a NADH-linked, homodimer enzyme having the role of acting on furfural which is a toxic inhibitor of microbial fermentations causing cell wall and membrane damage, DNA breakdowns and reduced enzymatic activities (Zheng, 2013; Liu, Ma & Song, 2009).

The enzyme catalyzes L-lactaldehyde and L-1,2- propanediol while dissimilating fucose in which acetaldehyde, ethylene glycerol, L-lactaldehyde and some more substances are used as substrates. Despite these, it takes an important role in furan reduction to its alcohol derivative (Wang et al., 2011).

Our circuit design for FucO gene

Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), FucO as protein coding region, double terminator (B0015) and suffix. This part enables our E. coli KO11 strain to convert toxic furfural into furfuryl alcohol. Our construct was inserted into pSB1C3 and delivered to the Registry.


Figure 1: Circuit design of Composite part 1 with FucO gene. BBa_K2571003. Our construct includes a strong promoter, RBS, FucO and double terminator.

In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting the amino acid sequence. We looked through the codon bias property of E. coli and made the nucleotide changes accordingly.

FucO has NADH-dependent furan reductase activity. When furfural is present in the field, the metabolism of furfural by NADPH-dependent oxidoreductases goes active in order to reduce it to its less toxic alcohol derivative-furfuryl alcohol (Zheng, 2013; Wang et al., 2013; Allen et al., 2010).


Figure 2: Effect of FucO overexpression in LY180 (Wang et al., 2011). The cell mass was observed in furfural containing medium. The FucO gene expressing L-1,2-propanediol oxidoreductase reduces the effect of furfural. The specific death rate of normal bacteria is observed to be higher than the specific death rate of bacteria with FucO gene. Thus, FucO is shown to increase the tolerance and lifespan of bacteria.

In this metabolism, the expression of oxidoreductases that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in E. coli by competing for biosynthesis with NADPH (Zheng, 2013).


Figure 3: The overexpression of FucO and YqhD and relationships with furfural resistance traits, metabolism, and reducing cofactors (Wang et al., 2013).

Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions shouldn’t be interfering with NADPH metabolism (Wang et al., 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol oxidoreductase (FucO) gene reduces furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis of NADPH (Wang et al., 2011).


Figure 4: 3D protein structure of L-1,2-propanediol oxidoreductase.

The protein structure of L-1,2-propanediol oxidoreductase was constructed by using Amber 14. It is demonstrated in ribbon diagram which is done by interpolating a smooth curve through the polypeptide backbone. The colors indicate the amino acids in the protein structure.


Figure 5: BBa_K2571003 check with FucO left and VR primers. Expected band length: 754 bp. Last three wells show positive results.

We’ve inserted the FucO composite part to pSB1C3 and pSB1A3 backbones. Then, we’ve transformed the construct for submission, BBa_K2571003, (in pSB1C3) to DH5⍺; and the other construct, for our biochemical assay, (in pSB1A3) to KO11. As we isolated the plasmids, we’ve done PCR with FucO left and VR primers to test orientation of our parts to the backbone. We expected a band of 754 bp between the FucO left and VR primers and the PCR results confirmed our expectations and showed that our parts were correctly inserted and transformed.

FucO Left and VR primers are as below:
FucO Left: GTGATAAGGATGCCGGAGAA
VR: ATTACCGCCTTTGAGTGAGC

Composite 2:

GSH:Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase

Reactive Oxygen Species (ROS) are dangerous substances that distort protein based matters by taking electrons (Lu, 2013). The chemical structure of the protein-based substances are altered and become dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011).

Furthermore; one of the most significant protein-based substance, DNA, gets attacked by OH radicals (Burton & Jauniaux, 2011). However, the reduced form GSH can protect the chemical structure of the proteins by donating extra electrons to ROS and free radicals (Lu, 2013). This is accomplished by GSH peroxidase-catalyzed reactions (Lu, 2013).


Figure 6: 3D protein structure of Bifunctional gamma-glutamate-cysteine ligase.

The protein structure of Bifunctional gamma-glutamate-cysteine ligase was constructed by using Amber 14. It is demonstrated in ribbon diagram which is done by interpolating a smooth curve through the polypeptide backbone. The colors indicate the amino acids in the protein structure.

Our circuit design for GSH gene

Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), GSH as protein coding region, double terminator (B0015) and suffix. This part enables our E. coli KO11 strain to overexpress oxidised Glutathione to reduce oxidative stress, increasing its lifespan (Lu, 2013). Our construct was inserted into pSB1C3 and delivered to the Registry.


Figure 7: Circuit design of Composite part 2 with GSH gene. BBa_K2571005. Our construct includes a strong promoter, RBS, GSH and double terminator.

In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting the amino acid sequence. We looked through the codon bias property of E. coli and made the nucleotide changes accordingly.


Figure 8: Because Glutathione prevents ROS from harming the bacteria, increase in cell mas was observed in high concentrations of Glutathione. In brief, when Glutathione concentration increases, the specific cell growth rate also increases and we observe an increase in the number of bacteria compared to the bacteria without the GSH gene (Kim & Hahn , 2013).

Figure 9: BBa_K2571005 check with GSH specific primers. Expected band length: 225 bp. Last six wells show positive results.

We’ve inserted the GSH composite part to pSB1C3 backbone. Then, we’ve transformed the construct for submission, BBa_K2571005, (in pSB1C3) to Dh4 alpha and conducted colony PCR. We’ve prepared the PCR with GSH specific primers and expected to see a result of 225 bp. By showing the band we expected, 225 bp, PCR confirmation for our insertion proved right.

GSH left and right primers are shown as below:
GSH left: TCGGAGGCTAAAACTCAGGA
GSH right: GTGGGCAGTCCAGTCGTAAT

Composite 3:

Dual Expression of FucO and GSH

The first protein coding region we have, placed after the RBS, FucO, will code for L-1,2-propanediol oxidoreductase (a homodimer enzyme) in order to act upon furfural presence in the field (Zheng, 2013). The metabolism of furfural by NAD(P)H-dependent oxidoreductases will reduce the toxicity of the chemical by turning it into a derivative, furfuryl alcohol, and increase the furfural tolerance (Zheng, 2013; Wang et al., 2013; Allen et al., 2010). Our second protein coding region, bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase (GSH), is a non-protein thiol group and a tripeptide composed of cysteine, glycine and glutamic acid (Lu, 2013). It is crucial for the detoxification of reactive oxygen species and free radicals (Ask et al. 2013). Reactive oxygen species (ROS) are harmful substances that alter protein based matters by taking electrons (Lu, 2013; Burton & Jauniaux, 2011). Because many benefits of GSH include scavenging of ROS, protection against endogenous toxic metabolites and detoxification of xenobiotics, we choose this gene to integrate with FucO (Höck et al., 2013). Thus we constructed a multi-functional gene providing long life span and resistance.

Design Notes of Dual Expression of FucO and GSH (BBa_K2571006)

Our construct for composite part 3 is composed of two stages, first the reduction of furans (specifically furfural and 5-HMF) and second the detoxification of reactive oxygen species (ROS). To achieve this effect, we designed our composite 3 part as with a prefix, a strong promoter (J23100), RBS (B0034), FucO as the first protein coding region (BBa_K2571003), RBS (B0034), GSH as the second protein coding region (BBa_K2571005), double terminator (B0015) and suffix.


Figure 10: Circuit design of Composite part 3 with FucO and GSH genes. BBa_K2571006. Our construct includes a strong promoter, RBS, FucO, RBS, GSH and double terminator.

Our construct was inserted into pSB1C3 and delivered to the Registry. Our construct was also inserted into pSB1A3 and transferred into KO11 to conduct further biochemical assays.

Given that FucO is NADH-dependent, it outperforms other oxidoreductases by not interfering with the NADPH metabolism of the organism while converting highly toxic substances, furfural and 5-HMF to non-harmful alcohols. This characteristic of FucO is crucial because the expression of oxidoreductases like Yqhd are NADPH-dependent, hence they compete with the biosynthesis for NADPH, which results in inhibiting the growth of the organism.

Glutathione, on the other hand, is recycled using NAD(P)H pathways and since its over-expression with NADH metabolism not being altered thanks to FucO, antioxidant capacity of the cell will be increased dramatically; resulting in amplified immunity to both furans and ROS, habilitated cell growth and increased ethanol yield by the virtue of increasing cell mass and reproduction, and improved metabolism.

Gel Results

Figure 11: BBa_K2571006 check with GSH and FucO specific primers. Expected band length: 194 bp. Green boxes show positive results.

We’ve inserted our composite part 3(BBa_K2571006) in both pSB1C3 and pSB1A3 backbones. The construct in pSB1C3 is for submission to registry and is cultivated in DH5 alpha. The plasmid having pSB1A3 as backbone, thus carrying ampicillin resistance is for our biochemical assays since we’ve chosen the chassis organism for assays as E.coli strain KO11 which already has Chloramphenicol resistance in its genome. After cloning our genes, we’ve made colony PCR to verify our insertions. We chose the primers as FucO specific since the composite 3 contains FucO coding region. Expected band length was 194 bp, and as expected, the bands were given by all of the DH5 alpha and KO11 colonies we chose, confirming our transformations.

FucO specific primers were used:
FucO left: GTGATAAGGATGCCGGAGAA
FucO right: CTTCTCGCCGGTAAAGTCAG

  • Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., Gorsich, S. W. (2010). Furfural induces reactive oxygen species accumulation and cellular damage in Saccharomyces cerevisiae. Biotechnology for Biofuels, 3, 2. http://doi.org/10.1186/1754-6834-3-2
  • Burton, G. J., & Jauniaux, E. (2011). Oxidative stress. Best Practice & Research. Clinical Obstetrics & Gynaecology, 25(3), 287–299. http://doi.org/10.1016/j.bpobgyn.2010.10.016
  • Chou, H.-H., Marx, C. J., & Sauer, U. (2015). Transhydrogenase Promotes the Robustness and Evolvability of E. coli Deficient in NADPH Production. PLoS Genetics, 11(2), e1005007. http://doi.org/10.1371/journal.pgen.1005007
  • Lu, S. C. (2013). Glutathione Synthesis. Biochemica et Biophysica Acta, 1830(5), 3143–3153. http://doi.org/10.1016/j.bbagen.2012.09.008
  • Liu, Z.L., Ma M., Song, M. (2009). Evolutionarily engineered ethanologenic yeast detoxifies lignocellulosic biomass conversion inhibitors by reprogrammed pathways. Mol Genet Genomics 282, 233-244. http://doi.org/10.1007/s00438-009-0461-7
  • National Center for Biotechnology Information. PubChem Compound Database; CID=124886, https://pubchem.ncbi.nlm.nih.gov/compound/124886 (accessed July 18, 2018). https://pubchem.ncbi.nlm.nih.gov/compound/124886#section=Top
  • Pizzorno, J. (2014). Glutathione! Integrative Medicine: A Clinician’s Journal, 13(1), 8–12. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/
  • Wang, X., Miller, E. N., Yomano, L. P., Zhang, X., Shanmugam, K. T., & Ingram, L. O. (2011). Increased Furfural Tolerance Due to Overexpression of NADH-Dependent Oxidoreductase FucO in Escherichia coli Strains Engineered for the Production of Ethanol and Lactate. Applied and Environmental Microbiology, 77(15), 5132–5140. http://doi.org/10.1128/AEM.05008-11
  • Wang, X & N Miller, E & Yomano, Lorraine & Zhang, Xueli & T Shanmugam, K & Ingram, Lonnie. ((2011). Increased Furfural Tolerance Due to Overexpression of NADH-Dependent Oxidoreductase FucO in Escherichia coli Strains Engineered for the Production of Ethanol and Lactate. Applied and environmental microbiology.
  • Xuan Wang, Lorraine P. Yomano, James Y. Lee, Sean W. York, Huabao Zheng,Michael T. Mullinnix, K. T. Shanmugam, and Lonnie O. Ingram, (2013), Engineering furfural tolerance in Escherichia coli improves the fermentation of lignocellulosic sugars into renewable chemicals. https://doi.org/10.1073/pnas.1217958110
  • Zheng, H., Wang, X., Yomano, L.P., Geddes, R. D, Shanmugan, K. T., Ingram, L.O. (2013). Improving Escherichia coli FucO for Furfural Tolerance by Saturation Mutagenesis of Individual Amino Acid Positions. Applied and Environmental Microbiology Vol 79, no 10.3202–3208. http://aem.asm.org/content/79/10/3202.full.pdf+html
  • Kim, D., & Hahn, J.-S. (2013). Roles of the Yap1 Transcription Factor and Antioxidants in Saccharomyces cerevisiae’s Tolerance to Furfural and 5-Hydroxymethylfurfural, Which Function as Thiol-Reactive Electrophiles Generating Oxidative Stress. Applied and Environmental Microbiology, 79(16), 5069–5077. http://doi.org/10.1128/AEM.00643-13