|
|
(104 intermediate revisions by 4 users not shown) |
Line 1: |
Line 1: |
− | <html> | + | <!--[if lt IE 8 ]><html class="no-js ie ie7" lang="en"> <![endif]--> |
− | | + | <!--[if IE 8 ]><html class="no-js ie ie8" lang="en"> <![endif]--> |
− | <head> | + | <!--[if (gte IE 8)|!(IE)]><!--> |
− | <style>
| + | <html class="no-js" lang="en"> |
− | #home_logo, #sideMenu { | + | <!--<![endif]--> |
− | display: none; | + | <head> |
| + | <!--- Basic Page Needs========================================================================= --> |
| + | <meta charset="utf-8"/> |
| + | <title></title> |
| + | <meta name="viewport" content="width=device-width, initial-scale=1.0, maximum-scale=1.2, user-scalable=yes" /> |
| + | <meta name="description" content="Wiki of Peking iGEM 2018" /> |
| + | <meta name="author" content="Peking iGEM"/> |
| + | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> |
| + | <!-- Mobile Specific Metas===================================================================== --> |
| + | <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1"/> |
| + | <!-- Fix Overwrite the original iGEM style=================================================== --> |
| + | <link href="https://2018.igem.org/Template:Peking/css/fix?action=raw&ctype=text/css" rel="stylesheet" /> |
| + | <!-- CSS======================================================================================= --> |
| + | <link href="https://2018.igem.org/Template:Peking/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet" /> |
| + | <link href="https://2018.igem.org/Template:Peking/css/style?action=raw&ctype=text/css" rel="stylesheet" /> |
| + | <!-- CSS======================================================================================= --> |
| + | <link rel="stylesheet" href="https://2018.igem.org/Template:Peking/css/default?action=raw&ctype=text/css"/> |
| + | <link rel="stylesheet" href="https://2018.igem.org/Template:Peking/css/layout?action=raw&ctype=text/css"/> |
| + | <link rel="stylesheet" href="https://2018.igem.org/Template:Peking/css/media-queries?action=raw&ctype=text/css"/> |
| + | <link rel="stylesheet" href="https://2018.igem.org/Template:Peking/css/notebook_panel?action=raw&ctype=text/css"/> |
| + | <style> |
| + | body { background: #D2D8D8 url(https://static.igem.org/mediawiki/2018/7/78/T--Peking--images_bodyBackground.jpeg); background-attachment:fixed;} |
| + | .texttitle{ |
| + | color:#6495ED; |
| + | font-size: 38px; |
| + | line-height: 48px; |
| + | margin-bottom: 12px; |
| + | font-family: raleway-bold, sans-serif !important; |
| + | background: transparent; |
| + | letter-spacing: 3px; |
| + | text-transform: uppercase; |
| + | font-weight: 350; |
| + | text-align: center; |
| + | padding-top:40px; |
| + | } |
| + | sup{font-size:11px;} |
| + | .references{margin-top:150px;margin-bottom:40px;} |
| + | .references p{font-size:14px !important; color:#666161 !important;} |
| + | .classic-title {font-weight: 300;padding-top:30px;} |
| + | .classic-title span { |
| + | padding-bottom: 8px; |
| + | border-bottom: 1px solid #383232; |
| + | font-weight: 400; |
| } | | } |
− | | + | figure{margin-top:40px;margin-bottom:40px;height:auto;} |
− | #sideMenu, #top_title, .patrollink { | + | .anchor{padding-top:100px;margin-top:-100px;} |
− | display: none; | + | </style> |
| + | |
| + | </head> |
| + | <body> |
| + | <!--sidebar 引用==============================================================================--> |
| + | <style> |
| + | #primary span{ |
| + | display:block; |
| + | word-break:break-all |
| + | } |
| + | |
| + | #page-wrap { |
| + | width: 25%; |
| + | margin: 0px; |
| + | position: relative; |
| } | | } |
− | | + | #page-wrap a:hover {color:#6495ED;} |
− | #content { | + | |
− | width: 100%;
| + | #sidebar { |
− | padding: 0px;
| + | width: 25%; |
− | margin-top: 0px; | + | |
| margin-left: 0px; | | margin-left: 0px; |
− | margin-right: 0px;
| |
| } | | } |
− | | + | @media (min-width:1024px){ |
− | body { | + | #sidebar{position:relative;top:120px;max-width:200px;}} |
− | background-color: #FAFAFA; | + | @media (max-width: 1023px){ |
− | !important; | + | #sidebar{display:none; |
| + | } |
| + | #page-wrap{display:none;} |
| } | | } |
− | | + | </style> |
− | #bodyContent h1, #bodyContent h2, #bodyContent h3, #bodyContent h4, #bodyContent h5 { | + | |
− | margin-bottom: 0px; | + | |
| + | <script type="text/javascript"> |
| + | function menuFixed(id){ |
| + | var obj = document.getElementById(id); |
| + | var _getHeight = obj.offsetTop; |
| + | |
| + | window.onscroll = function(){ |
| + | changePos(id,_getHeight); |
| + | } |
| + | } |
| + | function changePos(id,height){ |
| + | var obj = document.getElementById(id);var windowBottom = $(window).scrollTop() + $(window).innerHeight(); |
| + | if(w>=1024){ |
| + | if($(window).scrollTop() + $(window).height() > $(document).height() - 230){ |
| + | $('#sidebar').fadeOut("fast");}else{$('#sidebar').fadeIn("fast");} |
| + | } |
| + | var scrollTop = document.documentElement.scrollTop || document.body.scrollTop -230; |
| + | var windowBottom = $(window).scrollTop() + $(window).innerHeight(); |
| + | var w = window.innerWidth; |
| + | |
| + | if(scrollTop < height){ obj.style.position = 'relative'; |
| + | }else{ |
| + | obj.style.position = 'fixed'; |
| + | } |
| } | | } |
− | a:link { | + | </script> |
− | text-decoration: none;
| + | |
− | }
| + | <script type="text/javascript"> |
| + | window.onload = function(){ |
| + | menuFixed('sidebar'); |
| + | } |
| + | </script> |
| + | <script> |
| + | function naver(id){ |
| + | var obj=document.getElementById(id); |
| + | var oPos=obj.offsetTop; |
| + | return window.scrollTo(0,oPos+250); |
| + | } |
| + | </script> |
| + | <!--sidebar 引用 end ==============================================================================--> |
| + | <!--panel 引用==================================================================================--> |
| + | <style type="text/css"> |
| + | .panel-default .panel-heading a{ |
| + | text-decoration: none; |
| + | display:block; |
| + | padding:10px; |
| + | } |
| + | .panel-heading.panel-title{ |
| + | text-decoration: none; |
| + | padding-top:0px; |
| + | padding-bottom:0px; |
| + | padding-left:0px; |
| + | padding-right:0px; |
| + | text-align:center; |
| + | font-size:19px; |
| + | |
| + | } |
| + | a[aria-expanded="true"] { |
| + | background-color:rgba(70, 73, 76, 0.95); |
| + | text-decoration: none; |
| + | color:white; |
| + | } |
| + | |
| + | .panel-default .panel-heading a[aria-expanded="false"]{ |
| + | -o-transition: background-color 1s linear; |
| + | -moz-transition: background-color 1s linear; |
| + | -khtml-transition: background-color 1s linear; |
| + | -webkit-transition: background-color 1s linear; |
| + | -ms-transition: background-color 1s linear; |
| + | transition: background-color 1s linear; |
| + | } |
| + | .panel-default .panel-heading a[aria-expanded="false"]:hover{ |
| + | background-color:rgba(70, 73, 76, 0.95); |
| + | text-decoration: none; |
| + | color:white; |
| + | } |
| + | .panel-default .panel-heading a[aria-expanded="true"]{ |
| + | -o-transition: opacity 1s linear; |
| + | -moz-transition: opacity 1s linear; |
| + | -khtml-transition: opacity 1s linear; |
| + | -webkit-transition: opacity 1s linear; |
| + | -ms-transition: opacity 1s linear; |
| + | transition: opacity 0.7s linear; |
| + | } |
| + | .panel-default .panel-heading a[aria-expanded="true"]:hover{ |
| + | opacity:0.7; |
| + | } |
| + | |
| + | .coll p a{ |
| + | color:#6495ED !important; |
| + | } |
| + | .coll p a:hover{ |
| + | color:#6495ED !important; |
| + | } |
| + | .coll { |
| + | width:100%; |
| + | float:left; |
| + | } |
| + | .coll .info { |
| + | width:6%; |
| + | font-size:11px; |
| + | color:#a4a4a4; |
| + | margin-top:0px; |
| + | float:left; |
| + | |
| + | } |
| + | .coll .content { |
| + | width:94%; |
| + | float:left; |
| + | margin-left:40px; |
| + | margin-top:-3px; |
| + | } |
| + | .coll .ordi { |
| + | width;100%; |
| + | margin:0px 0px 0px 0px; |
| + | font-size:35px; |
| + | font-style:italic; |
| + | float:left; |
| + | color:#1E90FF; |
| + | opacity:0.8; |
| + | } |
| + | |
| + | </style> |
| + | |
| + | <script type="text/javascript"> |
| + | $(document).ready(function(){ |
| + | $("#button1").click(function(){ |
| + | $(".panel-collapse").collapse("show"); |
| + | }); |
| + | }); |
| + | $(document).ready(function(){ |
| + | $("#button2").click(function(){ |
| + | $(".panel-collapse").collapse("hide"); |
| + | }); |
| + | }); |
| + | $("#notebook").addClass("navbar-active"); |
| + | </script> |
| + | <!--panel 引用 end ==================--> |
| + | |
| + | <!-- Navigation --> |
| + | <div id="navigation" class="navbar navbar-fixed-top"> |
| + | <div class="navbar-inner "> |
| + | <div class="container no-padding"> |
| + | <a class="show-menu" data-toggle="collapse" data-target=".nav-collapse"><span class="show-menu-bar"></span> |
| + | </a> |
| + | <div id="logo" style="max-width:0px"><a class="" href="https://2018.igem.org/Team:Peking"><img |
| + | src="https://static.igem.org/mediawiki/2018/3/36/T--Peking--Logo.png"></a></div> |
| + | |
| + | <div class="nav-collapse collapse"> |
| + | <ul class="nav"> |
| | | |
− | a:visited {
| + | <li class="menu-1"><a class="colapse-menu1" href="https://2018.igem.org/Team:Peking">Home</a> |
− | text-decoration: none;
| + | </li> |
− | }
| + | |
| | | |
− | a:active {
| + | <li class="dropdown menu-2"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Project</a> |
− | text-decoration: none;
| + | <ul class="dropdown-menu"> |
− | }
| + | <li><a href="https://2018.igem.org/Team:Peking/Project" class="barfont1">Description</a></li> |
| + | <li><a href="https://2018.igem.org/Team:Peking/Design" class="barfont1">Design</a></li> |
| + | <li><a href="https://2018.igem.org/Team:Peking/Demonstrate" class="barfont1">Demonstration</a></li> |
| + | <li><a href="https://2018.igem.org/Team:Peking/Perspective" class="barfont1">Perspective</a></li> |
| + | </ul> |
| + | </li> |
| + | <li class="menu-3"><a class="colapse-menu1" href="https://2018.igem.org/Team:Peking/Model">Modeling</a> |
| + | </li> |
| + | <li class="menu-4"><a class="colapse-menu1" href="https://2018.igem.org/Team:Peking/Software">Software</a> |
| + | </li> |
| | | |
− | a:hover {
| |
− | }
| |
− | .dropbtn {
| |
− | background-color: #4CAF50;
| |
− | color: white;
| |
− | padding: 16px;
| |
− | font-size: 16px;
| |
− | border: none;
| |
− | cursor: pointer;
| |
− | }
| |
| | | |
− | .dropdown { | + | <li class="menu-6"><a class="colapse-menu1" href="https://2018.igem.org/Team:Peking/Human_Practices">Human Practices</a> |
− | position: relative;
| + | </li> |
− | display: inline-block;
| + | <li class="dropdown menu-7"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Achievement</a> |
− | }
| + | <ul class="dropdown-menu"> |
| + | <li><a href="https://2018.igem.org/Team:Peking/Judging_Form" class="barfont1">Judging Form</a></li> |
| + | <li><a href="https://2018.igem.org/Team:Peking/Parts" class="barfont1">Parts</a></li> |
| + | <li><a href="https://2018.igem.org/Team:Peking/Improve" class="barfont1">Improvement</a></li> |
| + | <li><a href="https://2018.igem.org/Team:Peking/InterLab" class="barfont1">InterLab</a></li> |
| | | |
− | .dropdown-content {
| + | </ul> |
− | display: none;
| + | </li> |
− | position: absolute;
| + | <li class="dropdown menu-8"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Lab</a> |
− | background-color: #f9f9f9;
| + | <ul class="dropdown-menu"> |
− | min-width: 140px;
| + | <li><a href="https://2018.igem.org/Team:Peking/Team_Members">Team Members</a></li> |
− | box-shadow: 0px 8px 16px 0px rgba(0,0,0,0.2);
| + | <li><a href="https://2018.igem.org/Team:Peking/Attributions" class="barfont1">Attributions</a></li> |
− | }
| + | <li><a href="https://2018.igem.org/Team:Peking/Notebook" class="barfont1">Notebook</a></li> |
| + | <li><a href="https://2018.igem.org/Team:Peking/Collaborations" class="barfont1">Collaborations</a></li> |
| + | <li><a href="https://2018.igem.org/Team:Peking/Safety" class="barfont1">Safety</a></li> |
| + | <li><a href="https://2018.igem.org/Team:Peking/Acknowledgement" class="barfont1">Acknowledgement</a></li> |
| + | |
| + | </ul> |
| + | </li> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | <!--/Navigation --> |
| + | |
| + | |
| + | <!-- Page Title======================================================================== --> |
| + | <div id="page-title"> |
| + | <div class="row"> |
| + | <div class="twelve columns centered text-center"> |
| + | <h1>Interlab</h1> |
| + | <!-- <p class="title1" style="text-align:justify; text-justify:inter-ideograph;">While people are constantly exploring the world, the greatest pursuit is to remould the world. While the ‘phase separation’ in cells is under investigation and in a research boom, the scientific community hopes that the the phenomenon ‘worth of millions of dollars’ can to be artificially designed to enhance original functions and even acquire new functions. Our team, Peking iGEM 2018 go all out to overcome the challenge: artificially designfulfill phase separation in cells and synthesize membraneless organelles.</p> --> |
| | | |
− | .dropdown-content a {
| + | </div> |
− | color: black;
| + | </div> |
− | padding: 12px 16px;
| + | </div><!-- Page Title End--> |
− | text-decoration: none;
| + | |
− | display: block;
| + | |
− | }
| + | <div id="page-content" class="row page"> |
| + | <div id="primary" class="twelve columns"> |
| + | <section> |
| + | <div class="row"> |
| + | |
| + | |
| + | <div class="three columns"> |
| + | <div id="page-wrap"> |
| + | <div id="sidebar" style="color:#000000"> |
| + | <h4><a href="javascript:void(0);" onclick="naver('A')">•Introduction</a></h4> |
| + | <h4><a href="javascript:void(0);" onclick="naver('B')">•Equipment Information</a></h4> |
| + | <h4><a href="javascript:void(0);" onclick="naver('C')">•Results</a></h4> |
| + | <ul> |
| + | <li><a href="javascript:void(0);" onclick="naver('D')">Calibration 1</a></li> |
| + | <li><a href="javascript:void(0);" onclick="naver('E')">Calibration 2</a></li> |
| + | <li><a href="javascript:void(0);" onclick="naver('F')">Calibration 3</a></li> |
| + | <li><a href="javascript:void(0);" onclick="naver('G')">Cell Measurement</a></li> |
| + | <ul> |
| + | <li><a href="javascript:void(0);" onclick="naver('H')">Plate Reader</a></li> |
| + | <li><a href="javascript:void(0);" onclick="naver('I')">Flow Cytometry</a></li> |
| + | </ul> |
| + | </ul> |
| + | <ul> |
| + | <li><a href="javascript:void(0);" onclick="naver('J')">Colony Forming Units</a></li> |
| + | </ul> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | |
| + | <div class="nine columns"> |
| + | |
| + | <div class="texttitle"><a id="A"></a>Introduction |
| + | </div> |
| + | <hr style="border:2px dashed; height:2px" color="#666666"> |
| | | |
− | .dropdown-content a:hover {background-color: #f1f1f1}
| + | <div class="coll"> |
| + | |
| + | <div class="content"> |
| + | <p>Peking 2018 joined the fifth Interlab measurement study. This year we helped to answer this question: Can we reduce lab-to-lab variability in fluorescence measurements by normalizing to absolute cell count or colony-forming units (CFUs) instead of OD? |
| | | |
− | .dropdown:hover .dropdown-content {
| + | </p> |
− | display: block;
| + | |
− | }
| + | |
| | | |
− | .dropdown:hover .dropbtn {
| + | <p> The introduction of this year Interlab: |
− | background-color: #3e8e41;
| + | <a href="https://2018.igem.org/Measurement/InterLab">https://2018.igem.org/Measurement/InterLab</a> |
− | }
| + | </p> |
− | u{ text-decoration:none}
| + | |
− | a{ text-decoration:none} | + | |
| | | |
| | | |
| | | |
| + | <!-- <div align="center"><img src="https://static.igem.org/mediawiki/2018/f/f1/T--Peking--project_design1.jpeg" width="300px" height="100 px" ></div> |
| + | <figcaption style="text-align:center;"> |
| + | Figure. 1 Overall design |
| + | </figcaption> |
| + | <br/><br/> --> |
| + | </div> |
| + | </div> |
| + | <div class="coll"> |
| + | |
| + | <p> |
| + | |
| + | </p> |
| + | |
| + | </div> |
| + | <div class="coll"> |
| + | |
| + | <div class="content"> |
| + | |
| + | </div> |
| + | </div> |
| + | <div class="coll"> |
| + | |
| + | |
| + | </div> |
| + | <div class="texttitle"><a id="B"></a>Equipment Information |
| + | </div> |
| + | <hr style="border:2px dashed; height:2px" color="#666666"> |
| | | |
− | /*Major body*/
| + | <div class="coll"> |
− | #MajorBody{position:absolute; top:24px; left:0px; width:1200px; height:1200px; background-color:#ffffff;}
| + | <div class="info"> |
− | #LeftNavigation{position:fixed; top:80px; float:left; width:200px; height:100%; background-color:#313131; z-index:1050;}
| + | |
− | #Content{position:absolute; left:200px;}
| + | </div> |
− | #ProjectList{position:absolute; top:40px; left:0px; color:#ffffff; font-family: calibri, arial, helvetica, sans-serif;}
| + | <div class="content"> |
− | #ProjectList > li {display:block; list-style-type:none; width:180px; height:30px; font-size:20px; text-align:left; background-color:transparent;}
| + | <!-- <p>To design multivalent modules, it is not ideal to use multiple repeat domains, which not only will make the protein extremely large and bring difficulties to DNA recombination, but also may be problematic for making transgenic animals. Thus, instead of using multiple repeats, we turned to de novo-designed homo-oligomeric coiled coils. And we named these coiled coils as HO-Tag (homo-oligomeric tag). They are short peptides, ~30 amino acids<sup>[1]</sup>, therefore they are ideal tags to introduce multivalency. There are seven coiled coils previously characterized in protein de novo design studies. They have been proved by previous work of Shu Xiaokun’s lab, and according to their work, HOTag3 and HOTag6 are most robust in driving protein droplet formation over a wide range of protein concentrations, so we choose them. |
− | .Left>a {color:#ffffff; text-decoration:none;} | + | </p>--> |
− | .Left:hover >a{color:#999999;} | + | |
| | | |
| + | <p> |
| + | Plate Reader: Perkin Elemer EnSpire <sup>TM</sup> Multilabel Reader 2300 |
| + | </p> |
| | | |
− | /*end of Major body*/ | + | <p> |
− | #AcknowledgementBox{ position:absolute; left:0px; top:590px; width:1200px;display:none;}
| + | Flow Cytometry: BD LSRFortessa <sup>TM</sup> Cell Analyzer |
| + | </p> |
| | | |
| + | <p> |
| + | 96 - Well Pate: Corning Incorporated Costar<sup>®️</sup> 3603 |
| | | |
| + | <p> |
| + | |
| + | </p> |
| | | |
| | | |
| | | |
| | | |
− | </style>
| + | </div> |
| + | <div class="coll"> |
| + | |
| + | |
| + | </div> |
| + | <div class="coll"> |
| + | |
| + | <div class="content"> |
| + | |
| + | </div> |
| + | </div> |
| + | <div class="coll"> |
| + | |
| + | |
| + | </div> |
| + | |
| + | |
| | | |
− | <link rel="stylesheet" type="text/css"
| + | <div class="texttitle"><a id="C"></a>Results |
− | href="https://2018.igem.org/Template:Peking/css/menubar?action=raw&ctype=text/css">
| + | |
− | <link rel="stylesheet" type="text/css"
| + | |
− | href="https://2018.igem.org/Template:Peking/css/main?action=raw&ctype=text/css">
| + | |
| | | |
| + | </div> |
| + | <hr style="border:2px dashed; height:2px" color="#1E90FF"> |
| + | <div class="coll"> |
| | | |
| + | <!-- |
| + | <div class="content"> |
| + | <p>To design interaction modules, we tried a lot of components and we fused them to the N-terminus of HOTag3 or HOTag6. Some of them are spontaneous and some are inducible. And we can regulate them through various kinds of inducers and different intensities of promoters.</p> |
| + | </div> |
| + | --> |
| + | <P> |
| + | |
| + | </P> |
| + | |
| | | |
− | </head> | + | <div class="coll"> |
| + | <div class="info"> |
| + | <a id="D"></a> |
| + | <div class="ordi">1.</div> |
| + | </div> |
| + | <div class="content"> |
| + | <h3>Calibration 1: OD600 Reference point - LUDOX</h3> |
| + | </div> |
| + | </div> |
| + | |
| + | <div class="coll"> |
| | | |
− | <body>
| + | <div class="content"> |
− | <div class="mdl-layout mdl-js-layout mdl-layout--fixed-header"> | + | <p> |
− | <header class="mdl-layout__header" style="position:fixed; margin-top: -9px; !important;">
| + | |
− | <div class="mdl-layout__header-row">
| + | </p> |
− | <!-- Title -->
| + | |
− | <a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking"
| + | |
− | style="color: #000000; font-size: x-large"><strong>Peking iGEM 2018</strong></a>
| + | |
− | <a href="https://2018.igem.org/Team:Peking"><img
| + | |
− | src="https://static.igem.org/mediawiki/2018/e/e2/T--Peking--_toolbar.jpeg" height="50"></a>
| + | |
− | <!-- Add spacer, to align navigation to the right -->
| + | |
− | <div class="mdl-layout-spacer"></div>
| + | |
− | <!-- Navigation. We hide it in small screens. -->
| + | |
− | <nav class="mdl-navigation mdl-layout--large-screen-only">
| + | |
| | | |
− | <a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking"
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/5/5a/T--Peking--ludox.png" ></div> |
− | style="color: #000; font-weight: 500;">Home</a>
| + | <figcaption style="text-align:center;"> |
− | <div class="dropdown">
| + | Figure. 1 The result of LUDOX calibration. The correction factor of our plate reader is 3.316 |
− | <span><a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking/Project">Project</a></span>
| + | </figcaption> |
− | <div class="dropdown-content">
| + | <br/><br/> |
− | <a href="https://2018.igem.org/Team:Peking/Description">Description</a>
| + | </div> |
− | <a href="https://2018.igem.org/Team:Peking/Design">Design</a>
| + | |
− | <a href="https://2018.igem.org/Team:Peking/Demonstrate">Demonstrate</a>
| + | |
− | <a href="https://2018.igem.org/Team:Peking/Future_Plan">Future Plan</a>
| + | <!-- |
− | </div></div>
| + | <p>Post-translational modifications by the small ubiquitin-like modifier (SUMO) are crucial events in cellular response to radiation and a wide range of DNA-damaging agents. Previous studies have shown that SUMO mediates protein-protein interactions by binding to a SUMO-interacting motif (SIM) on receptor proteins. And recent studies have shown that a protein with ten repeats of human SUMO3 (polySUMO) and a protein with ten repeats of SIM (polySIM) can phase separate in vitro<sup>[3]</sup>. Therefore, we chose SUMO3 and SIM as a pair of interaction modules and they can drive the formation of synthetic organelles spontaneously. For plasmid construction, in order to make synthetic organelles visible, we chose mCherry (red fluorescent protein) and yEGFP (yeast-enhanced green fluorescent protein) as reporters. Then, we fused mCherry between the C-terminus of SIM and the N-terminus of HOTag6. Similarly, we fused yEGFP between the C-terminus of SUMO and the N-terminus of HOTag3. We transformed them into yeast and proved that they can stably express. If it work, we will find red granules colocalize with green granules in cells under fluorescence microscope. </p> |
− | <div class="dropdown">
| + | --> |
− | <span><a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking/Results">Data Page</a></span>
| + | <!-- |
− | <div class="dropdown-content">
| + | |
− | <a href="https://2018.igem.org/Team:Peking/Phase_Separation_D">Phase Separation</a>
| + | <figcaption style="text-align:justify; text-justify:inter-ideograph;"> |
− | <a href="https://2018.igem.org/Team:Peking/Function_D">Function</a>
| + | Figure. 3A Structure of SUMO3 and SIM. Modification of proteins by SUMO are recognized by SUMO-interacting motifs termed SIMs. In natural process, polySUMOylation recruits distinct interaction partners, such as E3 ubiquitin ligases, that bind to polySUMO chains through tandem SIMs. SIMs bind to a surface patch between the α-helix and a β-sheet of the SUMO protein and extend the β-sheet of SUMO by one additional strand. the SIM either attaches as a parallel or an antiparallel strand to the SUMO β-sheet. Binding is primarily mediated by a stretch of four residues containing 3–4 hydrophobic amino acids (I, V, or L). This core interaction motif is a common property of all SIMs<sup>[4]</sup>. |
− | </div></div>
| + | Figure. 3B Pattern diagram of SUMO-yeGFP and SIM-mCherry. YeGFP is fused to the C-terminus of SUMO and to the N-terminus of HOTag3, mCherry is fused to the C-terminus of SIM and to the N-terminus of HOTag6. |
− | <div class="dropdown">
| + | |
− | <span><a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking/Model">Model</a></span>
| + | </figcaption> |
− | <div class="dropdown-content"> | + | </div></div> |
− | <a href="https://2018.igem.org/Team:Peking/Phase_Separation_M">Phase Separation</a>
| + | </div> |
− | <a href="https://2018.igem.org/Team:Peking/Function_M">Function</a>
| + | |
− | </div></div>
| + | --> |
− | <div class="dropdown">
| + | |
− | <span><a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking/Software">Software</a></span></div>
| + | <p> |
− | <div class="dropdown">
| + | |
− | <span><a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking/Human_Practices">Human Practices</a></span>
| + | </p> |
− | <div class="dropdown-content">
| + | |
− | <a href="https://2018.igem.org/Team:Peking/HumanPractices">Human Practices</a>
| + | |
− | <a href="https://2018.igem.org/Team:Peking/Public_Engagement">Public Engagement</a>
| + | |
− | </div></div>
| + | |
− | <div class="dropdown">
| + | |
− | <span><a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking/Team">Team</a></span>
| + | |
− | <div class="dropdown-content">
| + | <div class="coll"> |
− | <a href="https://2018.igem.org/Team:Peking/Team">Team Members</a>
| + | <div class="info"> |
− | <a href="https://2018.igem.org/Team:Peking/Attributions">Attributions</a>
| + | <a id="E"></a> |
− | <a href="https://2018.igem.org/Team:Peking/Safety">Safety</a>
| + | <div class="ordi">2.</div> |
− | <a href="https://2018.igem.org/Team:Peking/Notebook">Notebook</a>
| + | |
− | <a href="https://2018.igem.org/Team:Peking/Experiments">Experiments</a>
| + | </div> |
− | </div></div>
| + | <div class="content"> |
− | <div class="dropdown">
| + | <h3>Calibration 2: Particle Standard Curve – Microsphere</h3> |
− | <span><a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking/Collaborations"><b>Collaborations</b></a></span>
| + | </div> |
− | <div class="dropdown-content">
| + | </div> |
− | <a href="https://2018.igem.org/Team:Peking/Acknowledgement">Acknowledgement</a>
| + | |
− | <a href="https://2018.igem.org/Team:Peking/InterLab">InterLab</a>
| + | <div class="coll"> |
− | </div></div>
| + | <p> |
− | <div class="dropdown">
| + | |
− | <span><a class="mdl-navigation__link" href="https://2018.igem.org/Team:Peking/Parts">Parts</a></span>
| + | </p> |
− | <div class="dropdown-content">
| + | |
− | <a href="https://2018.igem.org/Team:Peking/Improve">Improve</a>
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/3/3a/T--Peking--standcurve1.png" ></div> |
− | </div></div>
| + | <figcaption style="text-align:center;"> |
− | <span>         </span></div>
| + | Figure. 2 The result of particle calibration. |
− | </nav>
| + | </figcaption> |
− | </div>
| + | <br/><br/> |
− | </header>
| + | </div> |
| + | |
| + | <table border="0"> |
| + | <tr> |
| + | <th><img src="https://static.igem.org/mediawiki/2018/3/35/T--Peking--standcurve2.png"></th> |
| + | <th><img src="https://static.igem.org/mediawiki/2018/a/a7/T--Peking--standcurve3.png"></th> |
| + | </tr> |
| + | <tr> |
| + | <th>(a) Particle Standard Curve - Linear</td> |
| + | <th>(b) Particle Standard Curve - Log Scale</td> |
| + | </tr> |
| + | <tr> |
| + | <th colspan="2"><div align="center">Figure. 3 The result of particle standard curve |
| + | |
| + | </div></td> |
| + | </tr> |
| + | </table> |
| + | |
| + | <p> |
| + | |
| + | </p> |
| + | |
| + | |
| + | |
| + | <div class="coll"> |
| + | <div class="info"> |
| + | <a id="F"></a> |
| + | <div class="ordi">3.</div> |
| + | |
| + | </div> |
| + | <div class="content"> |
| + | <h3>Calibration 3: Fluorescence standard curve – Fluorescein</h3> |
| + | </div> |
| + | </div> |
| + | |
| + | <div class="coll"> |
| + | |
| + | <div class="content"> |
| + | |
| + | </div> |
| + | </div> |
| + | |
| + | <div class="coll"> |
| + | |
| + | <div class="content"> |
| + | |
| + | <p> |
| + | |
| + | </p> |
| + | |
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/2/25/T--Peking--fluroscencestandcurve1.png" ></div> |
| + | <figcaption style="text-align:center;"> |
| + | Figure. 4 The result of fluorescein calibration. |
| + | </figcaption> |
| + | <br/><br/> |
| + | </div> |
| + | |
| + | <table border="0"> |
| + | <tr> |
| + | <th><img src="https://static.igem.org/mediawiki/2018/e/e8/T--Peking--fluroscencestandcurve2.png"></th> |
| + | <th><img src="https://static.igem.org/mediawiki/2018/7/7d/T--Peking--fluroscencestandcurve3.png"></th> |
| + | </tr> |
| + | <tr> |
| + | <th>(a) Fluorescence Standard Curve - Linear</td> |
| + | <th>(b) Fluorescence Standard Curve - Log Scale</td> |
| + | </tr> |
| + | <tr> |
| + | <th colspan="2"><div align="center">Figure. 5 The result of fluorescence standard curve |
| + | |
| + | </div></td> |
| + | </tr> |
| + | </table> |
| + | |
| + | <p> |
| + | |
| + | </p> |
| + | |
| + | |
| + | |
| + | <div class="coll"> |
| + | <div class="info"> |
| + | |
| + | |
| + | </div> |
| + | </div> |
| + | |
| + | <div class="coll"> |
| + | |
| + | <div class="content"> |
| + | |
| + | </div> |
| + | </div> |
| + | |
| + | |
| + | |
| + | |
| + | <div class="texttitle"><a id="G"></a>Cell Measurement |
| | | |
| </div> | | </div> |
| + | <hr style="border:2px dashed; height:2px" color="#1E90FF"> |
| + | <div class="coll"> |
| | | |
| + | <div class="content"> |
| + | <!-- |
| + | <p>Now, we have artificially designed phase separation in cells and synthesized membraneless organelles. But how can we fulfill intended functions with synthetic organelles? Here, we propose two ideas. We reserve two sites to implement functions, which means function modules, such as enzymes in metabolism, proteins in signaling pathway, transcription factors in transcription and so on, have two sites in our designs.</p> |
| + | </div> |
| + | --> |
| | | |
− | <!--MajorBody--> | + | <p> |
− | <div id="MajorBody">
| + | |
− | <div id="LeftNavigation">
| + | </p> |
− | <ul id="ProjectList">
| + | |
− | <li class="Left"><a href="https://2018.igem.org/Team:Peking/Collaborations"><b>Collaborations</b></a></li><br/><br/>
| + | |
− | <li class="Left"><a href="https://2018.igem.org/Team:Peking/Acknowledgement">◊   Acknowledgement</a><li>
| + | |
− | <li class="Left"><a href="https://2018.igem.org/Team:Peking/InterLab">>   InterLab</a><li>
| + | |
− | </ul>
| + | |
− | </div>
| + | |
− |
| + | |
| | | |
− | <div class="two_thirds_size" > | + | <p> |
− | <p>Welcome to our wiki!</p> | + | Materials: |
| + | </p> |
| + | <p> |
| + | Competent cells (Escherichia coli strain DH5α) |
| + | <br/> |
| + | LB (Luria Bertani) media |
| + | <br/> |
| + | Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH) |
| + | <br/> |
| + | 50 ml Falcon tube (or equivalent, preferably amber or covered in foil to block light) Incubator at 37°C |
| + | <br/> |
| + | 1.5 ml eppendorf tubes for sample storage |
| + | <br/> |
| + | Ice bucket with ice |
| + | <br/> |
| + | Micropipettes and tips |
| + | <br/> |
| + | 96 well plate, black with clear flat bottom preferred |
| + | </p> |
| | | |
− | </div> | + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/8/8a/T--Peking--interlabdevice.png" ></div> |
− | <div id="Content"> | + | <figcaption style="text-align:center;"> |
− | <div class="nine columns texttext"> | + | Figure. 6 The required test devices. |
− | <div class="texttitle">Methods</div>
| + | </figcaption> |
− | <div>
| + | <br/><br/> |
− | <a id="background"></a>
| + | </div> |
− | <h3 class="classic-title";"><span>Background</span></h3>
| + | <br/> |
− | <p>“All of the 2016 iGEM teams are invited and encouraged to participate in the Third International InterLaboratory Measurement Study in synthetic biology.” Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in common, comparable or absolute units. In our case, we measured fluorescence using plate reader.
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/5/55/T--Peking--devicelocation.png" ></div> |
− | </p>
| + | <figcaption style="text-align:center;"> |
− | </div>
| + | Figure. 7 The localization of each device on the 96-well plate. |
| + | </figcaption> |
| + | <br/><br/> |
| + | </div> |
| + | |
| + | |
| + | <div class="coll"> |
| + | <div class="info"> |
| + | <a id="H"></a> |
| + | <div class="ordi">1.</div> |
| + | </div> |
| + | <div class="content"> |
| + | <h3>Plate Reader</h3> |
| + | </div> |
| + | </div> |
| + | |
| + | <div class="coll"> |
| + | |
| + | <div class="content"> |
| + | |
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/5/57/T--Peking--rawplatereadings1.png" ></div> |
| | | |
− | <div>
| + | <br/> |
− | <a id="design"></a>
| + | </div> |
− | <h3 class="classic-title";"><span>Design</span></h3>
| + | |
− | <p>Fluorescence is widely used as a proxy for promoter activity by expressing fluorescent proteins such as green fluorescent protein (GFP). Despite this is an indirect measurement, it provides a useful insight into expression levels and has significant advantage that it could be ontinuously monitored without disrupting cells.
| + | |
− | </p>
| + | |
− | <p>Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.</p>
| + | |
− | <p>We aim to do this using the supplied FITC as a standard reference material. The standard curve could be constructed via measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform your relative measurements of fluorescence into absolute measurements of GFP molecules.</p>
| + | |
− | <p>However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.</p>
| + | |
− | </div>
| + | |
− |
| + | |
| | | |
− | <div>
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/0/02/T--Peking--rawplatereadings2.png" ></div> |
− | <a id="materials"></a>
| + | <figcaption style="text-align:center;"> |
− | <h3 class="classic-title";"><span>Materials and methods</span></h3>
| + | Figure. 8 The raw readings of Abs 600 and fluorescence by the plate reader. |
− | <h5>Plasmids used</h5>
| + | </figcaption> |
− | <p style="margin:0 0 0 0">• Plasmid DNA (100 pg/uL in 10uL of Buffer EB)</p>
| + | |
− | <div style="padding-left:20px">
| + | |
− | <p>
| + | |
− | o Test Device 1: J23101.B0034.E0040.B0015 in pSB1C3<br>
| + | |
− | o Test Device 2: J23106.B0034.E0040.B0015 in pSB1C3<br>
| + | |
− | o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3<br>
| + | |
− | o Positive Control Device: I20270 in pSB1C3 (Also located in Kit Plate 3, well 8P)<br>
| + | |
− | o Negative Control Device: R0040 in pSB1C3 (Also located in Kit Plate 2, well 6F)<br>
| + | |
− | </p>
| + | |
− | </div>
| + | |
− |
| + | |
| | | |
− | <h5>Strain used</h5>
| + | <br/> |
− | <p>• <i>Escherichia coli</i> TOP10</p>
| + | <br/> |
− |
| + | |
− | <h5>Materials</h5>
| + | |
− | <p>
| + | |
− | • FITC Standard: one tube with dried down FITC for creating a FITC standard<br>
| + | |
− | • LUDOX: one tube with 30% colloidal silica suspended in 1mL of water<br>
| + | |
− | • 1xPBS (phosphate buffered saline)<br>
| + | |
− | • LB (Luria Bertani) media<br>
| + | |
− | • Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH)<br>
| + | |
− | • 50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth<br>
| + | |
− | • 1.5 ml eppendorf tubes for sample storage<br>
| + | |
− | • Ice bucket with ice<br>
| + | |
− | • Pipettes<br>
| + | |
− | • 96 well plate <br>
| + | |
− | </p>
| + | |
− |
| + | |
− | <h5>Machines</h5>
| + | |
− | <p>
| + | |
− | • Thermo VARIOSKAN FLASH<br>
| + | |
− | • MAPADA UV-3100PC SPECTROPHOTOMETER<br>
| + | |
− | • YKKY(FM40)<br>
| + | |
− | • AISITE electro-heating standing-temperature cultivator<br>
| + | |
− | • HONOUR INCURATOR SHAKER<br>
| + | |
− |
| + | |
− | </p>
| + | |
| | | |
− | <h5>Software</h5>
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/e/ec/T--Peking--fluorescence_per_od1.png" ></div> |
− | <p>
| + | |
− | • Microsoft Excel<br>
| + | <br/> |
− |
| + | </div> |
− | </p> | + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/6/69/T--Peking--fluorescence_per_od2.png" ></div> |
| + | |
| + | <br/> |
| + | </div> |
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/7/7b/T--Peking--fluorescence_per_od3.png.png" ></div> |
| + | <figcaption style="text-align:center;"> |
| + | Figure. 9 The fluorescence per OD. |
| + | </figcaption> |
| + | <br/> |
| | | |
− | <h5>Methods</h5>
| + | <br/> |
− | <p style="margin:0 0 0 0">• Calibration</p>
| + | |
− | <div style="padding-left:45px">
| + | |
− | <p>
| + | |
− | o OD600 Reference point<br>
| + | |
− | o FITC fluorescence standard curve<br>
| + | |
− | o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3<br>
| + | |
− | </p>
| + | |
− | </div>
| + | |
− | <p style="margin:0 0 0 0">• Cell measurement</p>
| + | |
− | <div style="padding-left:45px">
| + | |
− | <p>
| + | |
− | o Transformation<br>
| + | |
− | o Measurements <br>
| + | |
− | </p>
| + | |
− | </div>
| + | |
| | | |
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/1/1a/T--Peking--fluorescence_per_particle1.png" ></div> |
| + | |
| + | <br/> |
| + | </div> |
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/6/6d/T--Peking--fluorescence_per_particle2.png" ></div> |
| + | |
| + | <br/> |
| + | </div> |
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/c/c4/T--Peking--fluorescence_per_particle3.png" ></div> |
| + | <figcaption style="text-align:center;"> |
| + | Figure. 10 The fluorescence per particle. |
| + | </figcaption> |
| + | <br/> |
| | | |
− | </div>
| |
| | | |
| + | </div> |
| + | <div class="coll"> |
| + | <div class="info"> |
| + | <a id="I"></a> |
| + | <div class="ordi">2.</div> |
| | | |
− | <a id="protocol"></a>
| + | </div> |
− | <h3 class="classic-title";"><span>Protocols</span></h3>
| + | <div class="content"> |
− | <div style="padding-left:45px">
| + | <h3>Flow Cytometry</h3> |
− | <p><a href="https://2016.igem.org/Team:Peking/Interlab/Protocol:Calibration">>>Calibration</a><br>
| + | </div> |
− | <a href="https://2016.igem.org/Team:Peking/Interlab/Protocol:Cell_measurement">>>Cell measurement</a></p>
| + | </div> |
− | </div>
| + | |
− |
| + | <br/> |
| | | |
− | <div class="texttitle">Description</div>
| + | <table border="0"> |
− | <img src="https://static.igem.org/mediawiki/2016/9/97/T--Peking--image_interlab_1.jpg">
| + | <tr> |
− | <br>
| + | <th><img src="https://static.igem.org/mediawiki/2018/1/14/T--peking--0hcolony1.png"></th> |
− | <img src="https://static.igem.org/mediawiki/2016/a/ab/T--Peking--image_interlab_2.jpg">
| + | <th><img src="https://static.igem.org/mediawiki/2018/8/81/T--peking--_0hcolony2.png"></th> |
− | <p style="text-align:center;"><b>Figure 1. Above: from left to right: D1, D2, D3, Negative, Positive. Below: five mediums containing five different bacteria.</b></p>
| + | </tr> |
− | <br>
| + | <tr> |
− | <p>Plasmids containing promoters and GFP were taken from The 2016 DNA Distribution Kit and all devices were transformed into <i>E. coli</i>. Fluorescence of colonies was checked up under UV light. </p>
| + | <th>(a) Colony 1</td> |
− | <p>5 ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.
| + | <th>(b) Colony 2</td> |
− | </p>
| + | </tr> |
− | <a id="sequencing"></a>
| + | <tr> |
− | <br>
| + | <th colspan="2"><div align="center">Figure. 11 The result of flow cytometry at 0h. |
− | <div class="texttitle">Results</div>
| + | |
− | <h3 class="classic-title";"><span>Sequencing</span></h3>
| + | |
− | <p> • Device 1: J23101+I13504<br>
| + | |
− | • Device 2: J23106+I13504<br>
| + | |
− | • Device 3: J23117+I13504<br>
| + | |
− | • Positive Control Device: I20270 in pSB1C3<br>
| + | |
− | • Negative Control Device: R0040 in pSB1C3 </p>
| + | |
− | <p> | + | |
− | >BBa_J23101 Part-only sequence (35 bp)<br>
| + | |
− | <span style="padding-left:45px">Tttacagctagctcagtcctaggtattatgctagc</span></p><p>
| + | |
− | >BBa_J23106 Part-only sequence (35 bp)<br> | + | |
− | <span style="padding-left:45px">Tttacggctagctcagtcctaggtatagtgctagc</span></p><p>
| + | |
− | >BBa_J23117 Part-only sequence (35 bp)<br>
| + | |
− | <span style="padding-left:45px">Ttgacagctagctcagtcctagggattgtgctagc</span></p><p>
| + | |
− | >BBa_I13504 Part-only sequence (875 bp)<br>
| + | |
− | <span style="padding-left:45px">Aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p>
| + | |
− | >BBa_I20270 Part-only sequence (919 bp)<br>
| + | |
− | <span style="padding-left:45px">Ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p>
| + | |
− | >BBa_R0040 Part-only sequence (54 bp)<br> | + | |
− | <span style="padding-left:45px">tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac</span>
| + | |
− | </p></p> | + | |
− |
| + | |
− | <a id="data"></a>
| + | |
− | <h3 class="classic-title";"><span>Data</span></h3>
| + | |
− | <h4>OD600 Reference Point</h4>
| + | |
− | <p><b>Table 1. OD600 Reference Point.</b></p>
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/f/f4/T--Peking--image_interlab_3.png">
| + | |
− | <br>
| + | |
− | <h4>FITC Standard Curve</h4>
| + | |
− | <p ><b>Table 2. Data of FITC standard curve.</b></p>
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/1/1b/T--Peking--image_interlab_4.png">
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/0/03/T--Peking--image_interlab_5.png">
| + | |
− | <p ><b>Figure 2. FITC standard curve.</b></p>
| + | |
− | <br>
| + | |
− | <h4>Normalization</h4>
| + | |
− | <p ><b>Table 3. Normalization.</b></p>
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/d/db/T--Peking--image_interlab_6.png">
| + | |
− | <br>
| + | |
− | <h4>Cell Measurement</h4>
| + | |
− | <p ><b>Table 4. Raw data of Abs600 measurement.</b></p>
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/0/04/T--Peking--image_interlab_7.png">
| + | |
− | <p ><b>Table 5. Blank subtraction and correction of Abs600 measurement.</b></p>
| + | |
− |
| + | |
| | | |
| + | </div></td> |
| + | </tr> |
| + | </table> |
| | | |
| + | <br/> |
| | | |
| + | <table border="0"> |
| + | <tr> |
| + | <th><img src="https://static.igem.org/mediawiki/2018/4/4f/T--peking--_6hcolony1.png"></th> |
| + | <th><img src="https://static.igem.org/mediawiki/2018/d/d7/T--peking--_6hcolony2.png"></th> |
| + | </tr> |
| + | <tr> |
| + | <th>(a) Colony 1</td> |
| + | <th>(b) Colony 2</td> |
| + | </tr> |
| + | <tr> |
| + | <th colspan="2"><div align="center">Figure. 12 The result of flow cytometry at 6h. |
| | | |
− | <img src="https://static.igem.org/mediawiki/2016/e/ee/T--Peking--image_interlab_8.png"> | + | </div></td> |
− | <img src="https://static.igem.org/mediawiki/2016/7/71/T--Peking--image_interlab_9.png">
| + | </tr> |
− | <p ><b>Figure 3. Blank subtraction and correction of Abs600 measurement.</b></p>
| + | </table> |
− | <p ><b>Table 6. Raw data of fluorescence measurement.</b></p>
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/5/52/T--Peking--image_interlab_10.png">
| + | |
− | <p ><b>Table 7. Blank substraction and correction of fluorescence measurement.</b></p>
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/3/32/T--Peking--image_interlab_11.png">
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/6/67/T--Peking--image_interlab_12.png">
| + | |
− | <p ><b>Figure 4. Blank subtraction and correction of fluorescence measurement.</b></p>
| + | |
− | <p ><b>Table 8.Raw data of Fl/Abs600.</b></p>
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/d/d3/T--Peking--image_interlab_13.png">
| + | |
− | <p ><b>Table 9. Raw data of average and SD.</b></p>
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/a/a1/T--Peking--image_interlab_14.png">
| + | |
− | <img src="https://static.igem.org/mediawiki/2016/0/07/T--Peking--image_interlab_15.png">
| + | |
− | <p ><b>Figure 4. Average level of devices.</b></p>
| + | |
| | | |
| + | <div class="coll"> |
| | | |
| + | <div class="content"> |
| + | <!-- <p>We introduce a magic protein, anti-GFP nanobody, which is very small (only 13-kDa, 1.5nm 2.5nm) and high-affinity (0.59nM) camelid antibody to GFP<sup>[8]</sup>. So we can use its characteristic to improve our designs. We can fuse GFP to the C-terminus of interaction modules and to the N-terminus of HOTags, and fuse function modules to the C-terminus of anti-GFP nanobodies. Then, with the help of interaction between anti-GFP nanobodies and GFP, synthetic organelles will “welcome” function modules, expected functions can be realized. You may ask: How does anti-GFP nanobody improve the design? Firstly, it will not make the protein extremely large and will reduce the effect on the structure of function modules, which can ensure the quality of functions. Secondly, it can bring components not belonging to the original structure to synthetic organelles, which can enlarge the enrichment range of synthetic organelles. Thirdly, it is easy to regulate the expression of target proteins. So you can see, nanobodies may do better and give you a surprise!</p> |
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/e/e5/T--Peking--project_design9.jpeg" width="400px" height="175 px" ></div> |
| + | <figcaption style="text-align:center;"> |
| + | Figure. 7 Interaction of anti-GFP nanobody and GFP |
| + | </figcaption> |
| + | --> |
| + | </div> |
| + | </div> |
| + | <div class="coll"> |
| + | |
| + | |
| + | |
| | | |
| + | |
| + | |
| | | |
− |
| + | |
| + | |
| | | |
− | <div class="texttitle">Discussion</div>
| + | <div class="texttitle"><a id="J"></a>Colony Forming Units per 0.1 OD600 E. coli cultures |
− | <p>It is noticeable that the promoter of the Device 1 is strongest followed by the promoter of the Device 2 and Device 3.</p>
| + | </div> |
| + | <hr style="border:2px dashed; height:2px" color="#666666"> |
| + | <div class="coll"> |
| + | <div class="content"> |
| + | <!-- |
| + | <p>We artificially designed phase separation in cells and synthesized membraneless organelles. And the main work to synthesize an organelle is to fulfill phase separation in a cell, so we stress the importance of interactions and multivalency. For these two aspects, we gave our ideas and the feasibility was analyzed. At last, we proposed two ideas to implement functions. We believe that in the near future, “millions of dollars” will no longer be a dream!</p> |
| + | --> |
| | | |
− | <h3 class="classic-title";"><span>Appendix</span></h3>
| |
− | <p>Individuals responsible for conducting InterLab study
| |
− | • Dong Yiming measured the devices.
| |
− | • Li Cheng processed the data.
| |
− | </p>
| |
− |
| |
| | | |
| + | <br/> |
| + | </div> |
| + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/8/8c/T--Peking--CFU.png" ></div> |
| + | <figcaption style="text-align:center;"> |
| + | Figure. 13 The count of colony forming units per 0.1 OD600 E. coli cultures. |
| + | </figcaption> |
| + | <br/> |
| | | |
− | </div>
| + | </div> |
− | </div> <!-- row End -->
| + | </div> |
| + | |
| + | |
| + | |
| + | |
| + | <div class="texttitle"><a id="K"></a>References |
| </div> | | </div> |
| + | <hr style="border:2px dashed; height:2px" color="#666666"> |
| + | <div class="coll"> |
| + | <div class="content"> |
| + | |
| + | <p> |
| + | <a href="https://static.igem.org/mediawiki/2018/0/09/2018_InterLab_Plate_Reader_Protocol.pdf"> [1] https://static.igem.org/mediawiki/2018/0/09/2018_InterLab_Plate_Reader_Protocol.pdf<a/> |
| + | </p> |
| + | <p> |
| + | <a href="https://static.igem.org/mediawiki/2018/e/ec/2018_InterLab_Flow_Cytometry_Protocol.pdf"> [2] https://static.igem.org/mediawiki/2018/e/ec/2018_InterLab_Flow_Cytometry_Protocol.pdf<a/> |
| + | <br/> |
| + | <br/> |
| + | </p> |
| + | </div> |
| + | </div> |
| + | |
| + | </div><!--9 columns end--> |
| + | |
| + | </div> |
| + | |
| + | |
| + | |
| + | |
| + | </div><!--row end--> |
| + | </section> |
| + | </div><!--12 columes end--> |
| + | </div><!--page-content end--> |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | <!-- footer============================================================================== --> |
| + | <style> |
| + | footer .copyright span:before { |
| + | content: "|"; |
| + | padding-left: 10px; |
| + | padding-right: 12px; |
| + | color: #b4bbbb; |
| + | } |
| + | footer .copyright span:after { |
| + | content: "|"; |
| + | padding-left: 10px; |
| + | padding-right: 12px; |
| + | color: #b4bbbb; |
| + | } |
| + | </style> |
| + | <footer id="page-footer"> |
| + | <footer id="page-footer"> |
| + | <div class="row,row1"> |
| + | <ul class="footer-social"> |
| + | <li class="col-md-6" id="PKU-administration" style="margin-bottom:25px;max-width:300px"> |
| + | <a href="http://dean.pku.edu.cn/pkudean/index.html"><img src="https://static.igem.org/mediawiki/2018/7/7a/T--Peking--images_PKU_Administration_logo.png"></a> |
| + | </li> |
| + | <li class="col-md-6" id="PKU-SLS" style="margin-bottom:25px;max-width:300px"> |
| + | <a href="http://www.bio.pku.edu.cn/"><img src="https://static.igem.org/mediawiki/2018/0/04/T--Peking--images_PKU_SLS_logo.png"></a> |
| + | </li> |
| + | |
| + | <li class="col-md-6" id="PKU-CQB" style="margin-bottom:25px;max-width:300px"> |
| + | <a href="http://cqb.pku.edu.cn/en/"><img src="https://static.igem.org/mediawiki/2018/e/e1/T--Peking--images_PKU_CQB_logo.png"></a> |
| + | </li> |
| + | |
| + | </ul> |
| + | </div> |
| + | <div class="row"> |
| + | <div class="twelve columns" > |
| + | <ul class="copyright"> |
| + | <!--<li>© 2014 Sparrow</li> --> |
| + | <li><a href="https://2018.igem.org/Team:Peking">Home</a> <a href="mailto:pekingigem2018@126.com">Contact</a></li> |
| + | <span> ©2018 PEKING IGEM. All Rights Reserved.</span> |
| + | <li><a href="http://getbootstrap.com/2.3.2/">Based on Bootstrap</a></li> |
| + | </ul> |
| + | </div> |
| + | <div id="go-top" style="display: block;"><a title="Back to Top" href="#">Go To Top</a></div> |
| + | </div> |
| | | |
− | </body>
| |
| | | |
| + | <!-- Footer End--> |
| + | |
| + | |
| + | <!-- Java Script======================================================================= --> |
| + | <script>window.jQuery || document.write('<script src="https://2018.igem.org/Template:Peking/Javascript/jquery_1_10_2_min?action=raw&ctype=text/javascript"><\/script>')</script> |
| + | <script type="text/javascript" src="https://2018.igem.org/Template:Peking/Javascript/jquery_migrate_1_2_1_min?action=raw&ctype=text/javascript"></script> |
| + | |
| + | <script src="https://2018.igem.org/Template:Peking/Javascript/jquery_flexslider?action=raw&ctype=text/javascript"></script> |
| + | <script src="https://2018.igem.org/Template:Peking/Javascript/doubleaptogo?action=raw&ctype=text/javascript"></script> |
| + | <script src="https://2018.igem.org/Template:Peking/Javascript/init?action=raw&ctype=text/javascript"></script> |
| + | |
| + | <!--quotations from flexslider: start--> |
| + | <script src='https://2018.igem.org/Template:Peking/Javascript/modernizr_js?action=raw&ctype=text/javascript'></script> |
| + | <script type='text/javascript' src='https://2018.igem.org/Template:Peking/Javascript/fjquery_polaroid?action=raw&ctype=text/javascript'></script> |
| + | <script type='text/javascript' src='https://2018.igem.org/Template:Peking/Javascript/fjquery_easing?action=raw&ctype=text/javascript'></script> |
| + | <script type='text/javascript' src='https://2018.igem.org/Template:Peking/Javascript/fjquery_transform_0_8_0_min?action=raw&ctype=text/javascript'></script> |
| + | <script type='text/javascript' src='https://2018.igem.org/Template:Peking/Javascript/fjquery_preloader?action=raw&ctype=text/javascript'></script> |
| + | <!--quotations from flexslider: end--> |
| + | |
| + | <!--quotations from black: start--> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/jquery?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/jquery_sticky?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/jquery_easing_1_3_pack?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/bootstrap_min?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/jquery_patallax_1_1_3?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/appear?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/modernizr?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/jquery_prettyPhoto?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/isotope?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/jquery_bxslider_min?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/jquery_cycle_all?action=raw&ctype=text/javascript" ></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/jquery_maximage?action=raw&ctype=text/javascript"></script> |
| + | <script type='text/javascript' src="https://2018.igem.org/Template:Peking/Javascript/scripts?action=raw&ctype=text/javascript "></script> |
| + | <!--quotations from black: end--> |
| + | |
| + | |
| + | </body> |
| </html> | | </html> |