Tugbainanc (Talk | contribs) |
Tugbainanc (Talk | contribs) |
||
Line 68: | Line 68: | ||
</p> | </p> | ||
− | <div class="col-md-12"> | + | <div class="col-md-12 parts-photo-box"> |
<img src="https://static.igem.org/mediawiki/2018/c/c5/T--METU_HS_Ankara--bparts01.jpg" /> | <img src="https://static.igem.org/mediawiki/2018/c/c5/T--METU_HS_Ankara--bparts01.jpg" /> | ||
<br /> | <br /> |
Revision as of 22:41, 1 October 2018
Basic Parts
Name | Type | Description | Designer | Length |
---|---|---|---|---|
BBa_K2571000 | FucO /L-1,2-propanediol oxidoreductase | Tugba Inanc & Ceyhun Kayihan | 1152bp | |
BBa_K2571001 | Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase | Tugba Inanc & Ceyhun Kayihan | 2268bp |
FucO (BBa_K2571000)
FucO is a protein-coding region that codes for L-1,2-propanediol oxidoreductase which is an NADH-linked, homodimer enzyme having the role of acting on furfural. Furfural is a highly toxic substance which inhibits is a toxic inhibitor of microbial fermentations causing cell wall and membrane damages, DNA breakdowns, DNA cleavages and reduced enzymatic activities (Zheng, 2013; Liu, Ma & Song, 2009).
In the presence of furfural, NADPH-dependent oxidoreductases goes active in order to reduce furfural into its less toxic alcohol derivative - furfuryl alcohol (Zheng, 2013; Wang et al., 2013; Allen et al., 2010). In this pathway, the expression of oxidoreductases that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in E. coli by competing with biosynthesis for NADPH (Zheng, 2013).
Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions shouldn’t be interfering with NADPH metabolism (Wang et al, 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol oxidoreductase (FucO) gene reduces furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis of NADPH (Wang et al, 2011).
Figure 1: BBa_K2571000: fucO was cloned into pSB1C3.
We’ve inserted the gene our FucO, which is our basic part 1,to pSB1C3 backbone and transformed it to DH5- alpha. After plasmid isolation, we’ve checked the orientation with FucO left and VR primers and expected to see a band of 625 bp.
FucO and VR primers are as below:
FucO left: GTGATAAGGATGCCGGAGAA
VR: ATTACCGCCTTTGAGTGAGC
GSH (BBa_K2571001)
GSH as is a protein-coding region that codes for Bifunctional gamma glutamate cysteine ligase/ Glutathione synthetase.
Glutathione (GSH) is known to be an important antioxidant that is a sulfur compound; a tripeptide composed of three amino acids (cysteine, glycine and glutamic acid) and a non-protein thiol (Pizzorno, 2014; Lu, 2013). GHS is, furthermore, found in thiol-reduced form which accounts for its strength as an antioxidant.
Reactive oxygen species (ROS) are harmful substances that distort protein based matters by taking electrons and also causes oxidative stress (Lu, 2013) which occur during the fermentation process and is another major setback. The chemical structure of the protein-based substances such as the DNA are altered and become therefore become dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011).
GSH is generally found in the thiol-reduced form which is crucial for detoxification of ROS and free radicals. which cause oxidative stress. (Lu, 2013; Burton & Jauniaux, 2011).
Antioxidants like GSH play an important role in the detoxification of ROS and reactive oxygen species by directly acting as electron donors;, changing the unbalanced electron state of the free radicals and turningand, turning them into less harmful substances or affect them indirectly by getting in the way of the expression of free radical generating enzymes (Lü et al., 2014).
Figure 3:BBa_K2571001: GSH was cloned into pSB1C3.
Figure 4: BBa_K2571001 check with GSH specific primers. Expected band length: 225 bp. GSH basic well show positive results.
We’ve inserted the geneour GSH, basic part 2, to pSB1C3 backbone and transformed it to DH5 alpha. After plasmid isolation, we’ve checked the orientation with GSH specific primers and expected to see a band of 225 bp.
GSH left and right primers are shown as below:
GSH left: TCGGAGGCTAAAACTCAGGA
GSH right: GTGGGCAGTCCAGTCGTAAT
- Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., … Gorsich, S. W. (2010). Furfural induces reactive oxygen species accumulation and cellular damage in Saccharomyces cerevisiae. Biotechnology for Biofuels, 3, 2. http://doi.org/10.1186/1754-6834-3-2