Difference between revisions of "Team:UI Indonesia/Parts"

Line 215: Line 215:
 
   <h6><b>Figure 1.</b> Affitoxin Biobrick.</h6></div><br>
 
   <h6><b>Figure 1.</b> Affitoxin Biobrick.</h6></div><br>
  
   <h5>Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev). The following sequences are the primers for PCR cloning.<br>
+
   <h5>Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev). The following sequences are the primers for PCR cloning.
 +
  <br>
 
     <ol>
 
     <ol>
 
       <li>PCR cloning primer forward : 5’ AGTTCAAGTGTCCGAGAA 3’<br>Specifications:</li>
 
       <li>PCR cloning primer forward : 5’ AGTTCAAGTGTCCGAGAA 3’<br>Specifications:</li>
 
         <ul style="list-style-type:circle">
 
         <ul style="list-style-type:circle">
           <li>Melting Temperature (Tm)&nbsp;&nbsp;&nbsp;&nbsp;: 60.2<sup>o</sup>C</li>
+
           <li>Melting Temperature (Tm) : 60.2<sup>o</sup>C</li>
           <li>GC content&nbsp;&nbsp;&nbsp;&nbsp;: 44.4%Tea</li>
+
           <li>GC content : 44.4%</li>
           <li>Hairpin structure energy formation&nbsp;&nbsp;&nbsp;&nbsp;: 0.64 kcal/mol</li>
+
           <li>Hairpin structure energy formation : 0.64 kcal/mol</li>
           <li>Self-dimer energy formation&nbsp;&nbsp;&nbsp;&nbsp;: -3.61 kcal/mol</li>
+
           <li>Self-dimer energy formation : -3.61 kcal/mol</li>
 
         </ul>
 
         </ul>
 
       <li>PCR cloning primer reverse : 5’ TAAGCGAGTGCCGTATTA 3’<br>Specifications:</li>
 
       <li>PCR cloning primer reverse : 5’ TAAGCGAGTGCCGTATTA 3’<br>Specifications:</li>
 
         <ul style="list-style-type:circle">
 
         <ul style="list-style-type:circle">
           <li>Melting Temperature (Tm)           : 60.1<sup>o</sup>C</li>
+
           <li>Melting Temperature (Tm) : 60.1<sup>o</sup>C</li>
           <li>GC content                         : 44.4%Tea</li>
+
           <li>GC content : 44.4%</li>
           <li>Hairpin structure energy formation : -1.36 kcal/mol</li>
+
           <li>Hairpin structure energy formation : -1.36 kcal/mol</li>
           <li>Self-dimer energy formation         : -3.61 kcal/mol</li>
+
           <li>Self-dimer energy formation : -3.61 kcal/mol</li>
 
         </ul>
 
         </ul>
 
     </ol>
 
     </ol>
 +
  <br>
 +
  Note: Both heterodimer energy formations are -3.61 kcal/mol. Additionally, the predicted specifications are based on <i>IDT Oligo Analyzer 3.1</i> server (https://sg.idtdna.com/calc/analyzer)  PCR solution is predicted to contain 0.2 mM dNTP, 50 mM Na<sup>+</sup>, 5 mM Mg<sup>2+</sup>, and 0.3 mM oligos.
 
   </h5><br>
 
   </h5><br>
  
   <h3><b>LuxAB-eYFP Fluorescence Resonance Energy Transfer (FRET) System<b></h3>
+
   <h5>Confirmation of gBlocks insertion into plasmid could be confirmed using PCR colony method using following primer. Note that HbT1 Fwd and HbT2 Rev is the same primer used in HT fragments to do PCR colony in Affitoxin gBlocks.
  <h5>Basically, a molecule is excited to higher energy state when it absorbs a photon energy. This molecule relaxes back to ground state when the energy is emitted back to the environment or transferred into another molecule. FRET is a phenomenon in which non-radioactive energy is transferred from excited donor molecule to acceptor molecule via dipole-dipole interactions. Molecules involved in this phenomenon are called fluorophores as they emit fluorescence according to their respective emission spectrum after absorbing higher photon energy. The fluorescence emission spectrum of donor fluorophore must overlap with the absorption and emission spectrum of acceptor fluorophore for FRET to occur. Furthermore, the efficiency of energy transfer is highly influenced by the physical proximity of interacting fluorophores, being the most efficient at several nanometers. Hence, FRET can be applicated to study the distance of macromolecules such as proteins at molecular level.</h5>
+
  <br>
   <h5>LuxAB and eYFP are one of the most widely studied paired fluorophores. In this case, LuxAB is the donor fluorophore as it emits cyan colored light with relatively high energy (peak emission at 490 nm). eYFP serves as the acceptor fluorophore when in close contact with LuxAB, as it absorbs high energy from LuxAB that is overlapped with its own absorption spectrum and emits yellow colored light with lower energy (peak emission at 530 nm). To be utilized in macromolecules interaction studies, LuxAB and eYFP should be incorporated with the molecules of interest. When the molecules of interest are in contact, energy transfer between LuxAB and eYFP will happen and its efficiency can be measured with fluorescence-lifetime imaging microscopy method.</h5><br>
+
    <ol>
 +
      <li>Primer HbT1 Fwd : 5’ CTTACGCTTCTGCCACAT 3’<br>Specifications:</li>
 +
        <ul style="list-style-type:circle">
 +
          <li>Melting Temperature (Tm) : 61.7<sup>o</sup>C</li>
 +
          <li>GC content : 50%</li>
 +
          <li>Hairpin structure energy formation : -0.84 kcal/mol</li>
 +
          <li>Self-dimer energy formation : -3.61 kcal/mol</li>
 +
        </ul>
 +
      <li>Primer HbT2 rev : 5’ CCCCTGACTGAGCATGAT 3’<br>Specifications:</li>
 +
        <ul style="list-style-type:circle">
 +
          <li>Melting Temperature (Tm) : 62.8<sup>o</sup>C</li>
 +
          <li>GC content : 55.6%</li>
 +
          <li>Hairpin structure energy formation : 0.57 kcal/mol</li>
 +
          <li>Self-dimer energy formation : -5.38 kcal/mol</li>
 +
        </ul>
 +
    </ol>
 +
   <br>
 +
  Note: Both heterodimer energy formation exhibits -5.04 kcal/mol free energy.
 +
  <br>
 +
  For iGEM biobrick submission, we would use prefix and suffix that contain EcoRI and PstI. HindIII site and BamHI are inserted upstream from prefix and downstream from suffix respectively. The Affitoxin contains only the last 54 amino acid from the R domain which has no cytotoxicity and significant enough to bind with HBEGF receptor.2 At the downstream of the sequence, designing six histidine amino acids is essential for His-tag protein purification, as well as characterizing the affitoxin and HBEGF-TAR receptor kinetics. Ribosome Binding Site (RBS) is located upstream within the gBlocks containing Shine-Dalgarno sequence as follow.<br>
 +
  RBS : 5' GAGCGGATTATATAAGGAGGTTAATC 3’
 +
  </h5><br>
 
</div>
 
</div>
  
Line 247: Line 271:
  
 
<div class="w3-content w3-container w3-padding-64">
 
<div class="w3-content w3-container w3-padding-64">
  <h5>Diphtheria is becoming a prominent issue in Indonesia as its incidence is increasing recently. It also causes various complications, leading to morbidity and mortality. We realized the urgency of fast, reliable, and cheap early detection method for diphtheria infection as one of means necessary for its eradication. Therefore, we created a chimeric between native <i>Escherichia coli</i> Tar chemotaxis receptor and human HB-EGF receptor so the bacterium may recognize diphtheria toxin. Moreover, we combined CheA and CheY in E. coli chemotaxis system with LuxAB and eYFP, respectively. When in contact, LuxAB and eYFP create resonance energy transfer system in which LuxAB gives its emission to eYFP. Without diphtheria toxin, CheA will be in phosphorylated state, allowing interaction with CheY and energy transfer, resulting in yellow color. Toxin binding into chimeric receptor will inhibit CheA phosphorylation, hindering interaction with CheY and energy transfer, resulting in blue color (i.e. LuxAB native color).</h5><br>
 
 
  <h3><b>Pathogenesis of Diphtheria: How Does <i>Corynebacterium diphtheriae</i> Cause the Disease?<b></h3>
 
  <h5><i>Corynebacterium diphtheriae</i> is a Gram-positive rod bacterium that causes diphtheria. It produces exotoxin with two fragments (AB toxin). Fragment B facilitates toxin internalization within host cell via endocytosis upon binding with HB-EGF receptor. Endosome internal environment allows catalytic process to split AB toxin into separate fragments, while fragment B forms a pore in endosome membrane, allowing fragment A to be transported into host cell cytoplasm. Fragment A then catalyzes modification of elongation factor 2 (EF-2), thereby attenuates protein synthesis and ultimately killing cell. This process underlies several complications found in patients with diphtheria, such as myocarditis, liver and kidney necrosis. In posterior pharynx, diphtheria infection leads to pseudomembrane formation, which is a local reaction and deposition of dead epithelial cells, bacteria, and immune cells enclosed within fibrin. Large formed pseudomembrane potentially causes respiratory tract obstruction and death.</h5><br>
 
 
  <h3><b>Tar-mediated Chemotaxis System in <i>Escherichia coli</i><b></h3>
 
  <h5>Chemotaxis system allows motile living cells to sensitize chemical signals in the environment and moving towards or away from them. This involves signal transduction processes mediated by ligand binding to chemoreceptor. In <i>E. coli</i>, chemotaxis mediated by methyl-accepting chemotaxis proteins (MCPs) has been widely studied. MCPs are transmembrane chemoreceptors with periplasmic ligand binding domain and cytoplasmic signaling domain. To date, four different <i>E. coli</i> MCPs have been identified: Tar, Tsr, Trg and Tap chemoreceptors.</h5>
 
  <h5>Tar chemoreceptor mediates E. coli movement away from nickel and cobalt (repellent molecules), and towards aspartate and maltose (attractant molecules). Its cytoplasmic domain is associated with two proteins, CheW and CheA. CheW mediates signal transduction from Tar chemoreceptor to CheA, while CheA has a kinase domain which autophosphorylates its own histidyl residue. Tar chemoreceptor undergoes conformational change upon repellent molecule binding, leading to CheA activation and thus transfers its phosphoryl group to CheY, a regulatory protein that phosphorylates FliM in basal body of bacterial flagellum. These processes eventually lead the bacterium to swim smoothly away from repellent substance. On the other hand, attractant molecule binding into Tar chemoreceptor inhibits CheA and thus phosphorylation of CheY and FliM will not happen. This causes the bacterial flagellum to rotate in opposite direction and facilitates the bacterium to swim towards attractant substance.</h5><br>
 
 
  <h3><b>LuxAB-eYFP Fluorescence Resonance Energy Transfer (FRET) System<b></h3>
 
  <h5>Basically, a molecule is excited to higher energy state when it absorbs a photon energy. This molecule relaxes back to ground state when the energy is emitted back to the environment or transferred into another molecule. FRET is a phenomenon in which non-radioactive energy is transferred from excited donor molecule to acceptor molecule via dipole-dipole interactions. Molecules involved in this phenomenon are called fluorophores as they emit fluorescence according to their respective emission spectrum after absorbing higher photon energy. The fluorescence emission spectrum of donor fluorophore must overlap with the absorption and emission spectrum of acceptor fluorophore for FRET to occur. Furthermore, the efficiency of energy transfer is highly influenced by the physical proximity of interacting fluorophores, being the most efficient at several nanometers. Hence, FRET can be applicated to study the distance of macromolecules such as proteins at molecular level.</h5>
 
  <h5>LuxAB and eYFP are one of the most widely studied paired fluorophores. In this case, LuxAB is the donor fluorophore as it emits cyan colored light with relatively high energy (peak emission at 490 nm). eYFP serves as the acceptor fluorophore when in close contact with LuxAB, as it absorbs high energy from LuxAB that is overlapped with its own absorption spectrum and emits yellow colored light with lower energy (peak emission at 530 nm). To be utilized in macromolecules interaction studies, LuxAB and eYFP should be incorporated with the molecules of interest. When the molecules of interest are in contact, energy transfer between LuxAB and eYFP will happen and its efficiency can be measured with fluorescence-lifetime imaging microscopy method.</h5><br>
 
 
</div>
 
</div>
  

Revision as of 10:42, 9 October 2018

AFFITOXIN
Using the wild-type diphtheria exotoxin to characterize HBEGF-TAR receptor could be harmful due to biosafety reason. To tackle this problem, our team design a much simplified diphtheria toxin by removing the domain that is deadly to the cell. This domain, named domain C, will be translocated into the cell with the aid of other domains in toxin called domain R and domain T. Additionally, R domain recognized the natural HBEGF receptor, and T domain will insert the C domain into the cell. Thus, C domain would catalyze NAD-dependent ADP-ribosylation of EF-2 and leads to cellular apoptosis1. This remodeled toxin, coined Affitoxin, is incorporated in the plasmids (such as pSB1C3 and pEQ80L) along with the following parts.

Figure 1. Affitoxin Biobrick.

Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev). The following sequences are the primers for PCR cloning.
  1. PCR cloning primer forward : 5’ AGTTCAAGTGTCCGAGAA 3’
    Specifications:
    • Melting Temperature (Tm) : 60.2oC
    • GC content : 44.4%
    • Hairpin structure energy formation : 0.64 kcal/mol
    • Self-dimer energy formation : -3.61 kcal/mol
  2. PCR cloning primer reverse : 5’ TAAGCGAGTGCCGTATTA 3’
    Specifications:
    • Melting Temperature (Tm) : 60.1oC
    • GC content : 44.4%
    • Hairpin structure energy formation : -1.36 kcal/mol
    • Self-dimer energy formation : -3.61 kcal/mol

Note: Both heterodimer energy formations are -3.61 kcal/mol. Additionally, the predicted specifications are based on IDT Oligo Analyzer 3.1 server (https://sg.idtdna.com/calc/analyzer) PCR solution is predicted to contain 0.2 mM dNTP, 50 mM Na+, 5 mM Mg2+, and 0.3 mM oligos.

Confirmation of gBlocks insertion into plasmid could be confirmed using PCR colony method using following primer. Note that HbT1 Fwd and HbT2 Rev is the same primer used in HT fragments to do PCR colony in Affitoxin gBlocks.
  1. Primer HbT1 Fwd : 5’ CTTACGCTTCTGCCACAT 3’
    Specifications:
    • Melting Temperature (Tm) : 61.7oC
    • GC content : 50%
    • Hairpin structure energy formation : -0.84 kcal/mol
    • Self-dimer energy formation : -3.61 kcal/mol
  2. Primer HbT2 rev : 5’ CCCCTGACTGAGCATGAT 3’
    Specifications:
    • Melting Temperature (Tm) : 62.8oC
    • GC content : 55.6%
    • Hairpin structure energy formation : 0.57 kcal/mol
    • Self-dimer energy formation : -5.38 kcal/mol

Note: Both heterodimer energy formation exhibits -5.04 kcal/mol free energy.
For iGEM biobrick submission, we would use prefix and suffix that contain EcoRI and PstI. HindIII site and BamHI are inserted upstream from prefix and downstream from suffix respectively. The Affitoxin contains only the last 54 amino acid from the R domain which has no cytotoxicity and significant enough to bind with HBEGF receptor.2 At the downstream of the sequence, designing six histidine amino acids is essential for His-tag protein purification, as well as characterizing the affitoxin and HBEGF-TAR receptor kinetics. Ribosome Binding Site (RBS) is located upstream within the gBlocks containing Shine-Dalgarno sequence as follow.
RBS : 5' GAGCGGATTATATAAGGAGGTTAATC 3’

HBEGF-TAR
Team UI Indonesia
  igemui2018@gmail.com