Name	Type	Description	Designer	Length
BBa_K2571003		FucO / L-1,2-propanediol oxidoreductase fucO	Tuğba İnanç & Ceyhun Kayıhan	1350bp
BBa_K2571005		GSH/ Bifunctional gamma-glutamate-cysteine ligase/glutathione synthetase	Tuğba İnanç & Ceyhun Kayıhan	2466bp
BBa_K2571006		Dual Expression of FucO and GSH	Tuğba İnanç & Ceyhun Kayıhan	3644bp

Composite Part 1:

FucO/ L-1,2-Propanediol Oxidoreductase

FucO is the gene that codes for L-1,2-propanediol oxidoreductase which is a NADH-linked, homodimer enzyme having the role of acting on furfural which is a toxic inhibitor of microbial fermentations causing cell wall and membrane damage, DNA breaks down and reduced enzymatic activities (Zheng, 2013; Liu, Ma & Song, 2009).

The enzyme catalyzes L-lactaldehyde and L-1,2- propanediol while dissimilating fucose in which acetaldehyde, ethylene glycerol, L-lactaldehyde and some more substances are used as substrates. Despite these, it takes an important role in furan reduction to its alcohol derivative (Wang et al., 2011).

Our circuit design for FucO gene

Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), FucO as protein coding region, double terminator (B0015) and suffix. This part enables our E. coli KO11 strain to convert toxic furfural into furfuryl alcohol. Our construct is inserted into pSB1C3 and delivered to the Registry.

Figure 1: Circuit design of Composite part 1 with FucO gene. BBa_K2571003. Our construct includes a strong promoter, RBS, Fuco and double terminator.

In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting the amino acid sequence. We looked through the codon bias property of E. coli and made the nucleotide changes accordingly.

FucO has NADH-dependent furan reductase activity. When furfural is present in the field, the metabolism of furfural by NADPH-dependent oxidoreductases go active in order to reduce it to its less toxic alcohol derivative-furfuryl alcohol (Zheng, 2013; Wang et al., 2013; Allen et al., 2010).

Figure 2: Effect of FucO overexpression in LY180 (Wang et al., 2011). The Cell Mass was observed in furfural containing medium. The FucO gene expressing L-1,2-propanediol oxidoreductase reduce the effect of furfural. The specific death rate of normal bacteria is observed to be bigger than the specific death rate of bacteria with FucO gene. Thus FucO shows to increase the tolerance of bacteria and lifespan.

In this metabolism, the expression of oxidoreductases that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in E. coli by competing for biosynthesis with NADPH (Zheng, 2013).

Figure 3: The overexpression of FucO and YqhD and relationships with furfural resistance traits, metabolism, and reducing cofactors (Wang et al., 2013).

Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions shouldn’t be interfering with NADPH metabolism (Wang et al., 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol oxidoreductase (FucO) gene reduces furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis of NADPH (Wang et al., 2011).

Figure 4: 3D protein structure of L-1,2-propanediol oxidoreductase Figure 5: BBa_K2571003 check with FucO left and VR primers. Expected band length: 754 bp. Last three wells show positive results.

We’ve inserted the FucO composite part to pSB1C3 and pSB1A3 backbones. Then, we’ve transformed the construct for submission, BBa_K2571003, (in pSB1C3) to DH5⍺; and the other construct, for our biochemical assay, (in pSB1A3) to KO11. As we isolated the plasmids, we’ve done PCR with FucO left and VR primers to test orientation of our parts to the backbone. We expected a band of 754 bp between the FucO left and VR primers and the PCR results confirmed our expectations and showed that our parts were correctly inserted and transformed.

VF2 and VR primers are as below:
FucO left: GTGATAAGGATGCCGGAGAA
VR: ATTACCGCCTTTGAGTGAGC

Composite 2:

GSH:Bifunctional gamma-glutamate-cysteine ligase/glutathione synthetase

Reactive Oxygen Species are dangerous substances that distort protein based matters by taking electrons (Lu, 2013). The chemical structure of the protein-based substances are altered and become dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011).

Furthermore, one of the most significant protein-based substance, DNA get attacked by OH radicals (Burton & Jauniaux, 2011). However, the reduced form GSH can protect the chemical structure of the proteins by giving extra electrons to the ROS and free radicals (Lu, 2013). This is accomplished by GSH peroxidase-catalyzed reactions (Lu, 2013).

Figure 6: 3D protein structure of Bifunctional gamma-glutamate-cysteine ligase

Our circuit design for GSH gene

Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), GSH as protein coding region, double terminator (B0015) and suffix. This part enables our E. coli KO11 strain to overexpress oxidised Glutathione to reduce oxidative stress, increasing its lifespan. (Lu, 2013) Our construct is inserted into pSB1C3 and delivered to the Registry.

Figure 7: Circuit design of Composite part 2 with GSH gene. BBa_K2571005. Our construct includes a strong promoter, RBS, GSH and double terminator.

In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting the amino acid sequence. We looked through the codon bias property of E.coli and made the nucleotide changes accordingly.

Figure 8: Because Glutathione prevents the ROS from harming the bacteria, in high glutathione concentration increase in cell mass was observed. In brief, when glutathione concentration increases, the specific cell growth rate also increases and we observe increase in number of bacteria compared to the bacteria without GSH gene (Kim & Hahn , 2013). Figure 9: BBa_K2571005 check with GSH specific primers. Expected band length: 225 bp. Last six wells show positive results.

We’ve inserted the GSH composite part to pSB1C3 backbone. Then, we’ve transformed the construct for submission, BBa_K2571005, (in pSB1C3) to Dh4 alpha and conducted colony PCR. We’ve made the PCR with GSH specific primers and expected to see a result of 225bp. By showing the band we expected, 225bp, PCR confirmation for our insertion proved right.

GSH left and right primers are shown as below:
GSH left: TCGGAGGCTAAAACTCAGGA
GSH right: GTGGGCAGTCCAGTCGTAAT

Composite 3:

Dual Expression of FucO and GSH

The first protein coding region we have, placed after the RBS, FucO, will code for L-1,2-propanediol oxidoreductase (a homodimer enzyme) in order to act upon furfural presence in the field (Zheng, 2013). The metabolism of furfural by NAD(P)H-dependent oxidoreductases will reduce the toxicity of the chemical by turning it into furfuryl alcohol, a derivative and increase the furfural tolerance (Zheng, 2013; Wang et al., 2013; Allen et al., 2010). Our second protein coding region, bifunctional gamma-glutamate-cysteine ligase/glutathione synthetase (GSH), is a non-protein thiol group and a tripeptide composed of cysteine, glycine and glutamic acid (Lu, 2013). It is crucial for the detoxification of reactive oxygen species and free radicals (Ask et al, 2013). Reactive oxygen species (ROS) are harmful substances that alter protein based matters by taking electrons (Lu, 2013; Burton & Jauniaux, 2011). Because many benefits of GSH include scavenging of ROS, protection against endogenous toxic metabolites and detoxification of xenobiotics, we choose this gene to entagrate with the FucO (Höck et al., 2013). Thus we constructed multi functional gene providing long life span and resistance.

Design Notes of Dual Expression of FucO and GSH (BBa_K2571006)

Our construct for composite part 3 is composed of two stages, first the reduction of furans (specifically furfural and 5-HMF) and second the detoxification of reactive oxygen species (ROS).-To achieve this effect, we designed our composite 3 part as with a prefix, a strong promoter (J23100), RBS (B0034), fucO as the first protein coding region (BBa_K2571003), RBS (B0034), GSH as the second protein coding region (BBa_K2571005), double terminator (B0015) and suffix.

Figure 10: Circuit design of Composite part 3 with FucO and GSH genes. BBa_K2571006. Our construct includes a strong promoter, RBS, FucO, RBS, GSH and double terminator.

Our construct is inserted into pSB1C3 and delivered to the Registry. Our construct is also inserted into pSB1A3 and transferred into KO11 to conduct further biochemical assays.

Given that fucO is NADH-dependent it outperforms other oxidoreductases, by not interfering with the NADPH metabolism of the organism while converting highly toxic substances, furfural and 5-HMF to non-harmful alcohols. This characteristic of fucO is crucial because the expression of oxidoreductases like Yqhd are NADPH-dependent, hence they compete with the biosynthesis for NADPH, which results in inhibiting the growth of the organism.

Glutathione, on the other hand, is recycled using NAD(P)H pathways and since now it will be overexpressed and with NADH metabolism is not being altered thanks to FucO, antioxidant capacity of the cell will be increased dramatically, result in amplified immunity to both furans and ROS, habilitating cell growth, increasing ethanol yield by the virtue of increasing cell mass and reproduction, and improved metabolism.

References

• Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., … Gorsich, S. W. (2010). Furfural induces reactive oxygen species accumulation and cellular damage in Saccharomyces cerevisiae. Biotechnology for Biofuels, 3, 2. http://doi.org/10.1186/1754-6834-3-2