(Prototype team page) |
Tugbainanc (Talk | contribs) |
||
Line 1: | Line 1: | ||
− | {{METU_HS_Ankara}} | + | {{METU_HS_Ankara/Inner_Header}} |
<html> | <html> | ||
+ | <header class="ct-pageHeader ct-pageHeader--type2 ct-u-shadowBottom--type2 ct-pageHeader--motive ct-pageHeader--hasDescription ct-u-paddingBoth10"> | ||
+ | <div class="container ct-u-triangleBottomLeft"> | ||
+ | <div class="row"> | ||
+ | <div class="col-md-12"> | ||
+ | <h1 class="text-capitalize ct-fw-600 ct-u-colorWhite"> | ||
+ | Composite Parts | ||
+ | </h1> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </header> | ||
− | <div class=" | + | <section class="ct-u-paddingBoth50"> |
− | < | + | <div class="container"> |
− | < | + | <img src="https://static.igem.org/mediawiki/2018/7/72/T--METU_HS_Ankara--partsbanner.jpg" /> |
− | < | + | <table class="table" style="font-size: 17px"> |
− | </ | + | <thead> |
+ | <tr> | ||
+ | <th>Name</th> | ||
+ | <th>Type</th> | ||
+ | <th>Description</th> | ||
+ | <th>Designer</th> | ||
+ | <th>Length</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr class="danger"> | ||
+ | <td><a href="">BBa_K2571003</a></td> | ||
+ | <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td> | ||
+ | <td>FucO / L-1,2-propanediol oxidoreductase</td> | ||
+ | <td>Tugba Inanc & Ceyhun Kayihan</td> | ||
+ | <td>1350bp</td> | ||
+ | </tr> | ||
+ | <tr class="warning" style="font-size: 17px"> | ||
+ | <td><a href="">BBa_K2571005</a></td> | ||
+ | <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td> | ||
+ | <td>GSH/ Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase</td> | ||
+ | <td>Tugba Inanc & Ceyhun Kayihan</td> | ||
+ | <td>2466bp</td> | ||
+ | </tr> | ||
+ | <tr class="info"> | ||
+ | <td><a href="">BBa_K2571006</a></td> | ||
+ | <td><img width="80" src="https://static.igem.org/mediawiki/2018/b/b5/T--METU_HS_Ankara--cparts01.jpg" /></td> | ||
+ | <td>Dual Expression of FucO and GSH</td> | ||
+ | <td>Tugba Inanc & Ceyhun Kayihan</td> | ||
+ | <td>3644bp</td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <h3>Composite Part 1:</h3> | ||
+ | <h4>FucO/ L-1,2-Propanediol Oxidoreductase</h4> | ||
+ | <p> | ||
+ | FucO is the gene that codes for L-1,2-propanediol oxidoreductase which is a NADH-linked, homodimer enzyme having the role of | ||
+ | acting on furfural which is a toxic inhibitor of microbial fermentations causing cell wall and membrane damage, DNA breakdowns | ||
+ | and reduced enzymatic activities (Zheng, 2013; Liu, Ma & Song, 2009). | ||
+ | </p> | ||
− | < | + | <p> |
+ | The enzyme catalyzes L-lactaldehyde and L-1,2- propanediol while dissimilating fucose in which acetaldehyde, ethylene glycerol, | ||
+ | L-lactaldehyde and some more substances are used as substrates. Despite these, it takes an important role in furan reduction | ||
+ | to its alcohol derivative (Wang et al., 2011). | ||
+ | </p> | ||
+ | <img src="https://static.igem.org/mediawiki/2018/7/70/T--METU_HS_Ankara--cparts06.jpg" /> | ||
+ | <h5>Our circuit design for FucO gene</h5> | ||
+ | <p> | ||
+ | Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), FucO as protein coding region, double terminator (B0015) | ||
+ | and suffix. This part enables our E. coli KO11 strain to convert toxic furfural into furfuryl alcohol. Our construct was inserted | ||
+ | into pSB1C3 and delivered to the Registry. | ||
+ | </p> | ||
− | < | + | <img src="https://static.igem.org/mediawiki/2018/0/03/T--METU_HS_Ankara--cparts02.jpg" /> |
− | < | + | <br /> |
− | < | + | <i style="font-size: 12px"> |
− | + | Figure 1: Circuit design of Composite part 1 with FucO gene. <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571003">BBa_K2571003.</a> | |
− | </ | + | Our construct includes a strong promoter, RBS, Fuco and double terminator. |
+ | </i> | ||
− | <p> | + | <p> |
− | + | In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting | |
+ | the amino acid sequence. We looked through the codon bias property of E. coli and made the nucleotide changes accordingly. | ||
+ | </p> | ||
+ | <p> | ||
+ | FucO has NADH-dependent furan reductase activity. When furfural is present in the field, the metabolism of furfural by NADPH-dependent oxidoreductases | ||
+ | goes active in order to reduce it to its less toxic alcohol derivative-furfuryl alcohol (Zheng, 2013; Wang et al., 2013; Allen et al., 2010). | ||
+ | </p> | ||
+ | <img src="https://static.igem.org/mediawiki/2018/0/0c/T--METU_HS_Ankara--cparts0121566415.jpg" /> | ||
+ | <br> | ||
+ | <i style="font-size: 12px"> | ||
+ | Figure 2: Effect of FucO overexpression in LY180 (Wang et al., 2011). The Cell Mass was observed in furfural containing medium. The FucO gene expressing | ||
+ | L-1,2-propanediol oxidoreductase reduces the effect of furfural. The specific death rate of normal bacteria is observed to be bigger than the specific | ||
+ | death rate of bacteria with FucO gene. Thus, FucO is shown to increase the tolerance and lifespan of bacteria. | ||
+ | </i> | ||
− | < | + | <p> |
− | + | In this metabolism, the expression of oxidoreductases that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in E. coli | |
− | + | by competing for biosynthesis with NADPH (Zheng, 2013). | |
− | + | </p> | |
− | + | ||
− | + | ||
+ | <img src="https://static.igem.org/mediawiki/2018/9/9d/T--METU_HS_Ankara--cparts04.jpg" /> | ||
+ | <br> | ||
+ | <i style="font-size: 12px"> | ||
+ | Figure 3: The overexpression of FucO and YqhD and relationships with furfural resistance traits, metabolism, and reducing cofactors (Wang et al., 2013). | ||
+ | </i> | ||
− | < | + | <p> |
− | + | Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions shouldn’t be | |
+ | interfering with NADPH metabolism (Wang et al., 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol oxidoreductase (FucO) gene | ||
+ | reduces furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis of NADPH (Wang et al., 2011). | ||
+ | </p> | ||
− | < | + | <img width="500" src="https://static.igem.org/mediawiki/2018/b/be/T--METU_HS_Ankara--cparts05.gif" /> |
+ | <br> | ||
+ | <i style="font-size: 12px; margin-bottom: 20px"> | ||
+ | Figure 4: 3D protein structure of L-1,2-propanediol oxidoreductase | ||
+ | </i> | ||
− | <br | + | <br> |
− | + | ||
− | + | ||
+ | <div class="col-md-6" style="margin-bottom: 30px"> | ||
+ | <img width="500" src="https://static.igem.org/mediawiki/2018/f/f1/T--METU_HS_Ankara--cparts07.jpg" /> | ||
+ | <br> | ||
+ | <i style="font-size: 12px; line-height: 0px !important"> | ||
+ | Figure 5: BBa_K2571003 check with FucO left and VR primers. Expected band length: 754 bp. Last three wells show positive results. | ||
+ | </i> | ||
+ | </div> | ||
+ | <div class="col-md-6"> | ||
+ | <p> | ||
+ | We’ve inserted the FucO composite part to pSB1C3 and pSB1A3 backbones. Then, we’ve transformed the construct for submission, | ||
+ | <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571003">BBa_K2571003</a>, (in pSB1C3) | ||
+ | to DH5⍺; and the other construct, for our biochemical assay, (in pSB1A3) to KO11. As we isolated the plasmids, we’ve done PCR with FucO left and VR | ||
+ | primers to test orientation of our parts to the backbone. We expected a band of 754 bp between the FucO left and VR primers and the PCR results confirmed | ||
+ | our expectations and showed that our parts were correctly inserted and transformed. | ||
+ | </p> | ||
+ | </div> | ||
+ | <div style="clear: both"></div> | ||
+ | <p> | ||
+ | VF2 and VR primers are as below: | ||
+ | <br > | ||
+ | FucO left: GTGATAAGGATGCCGGAGAA | ||
+ | <br > | ||
+ | VR: ATTACCGCCTTTGAGTGAGC | ||
+ | |||
+ | </p> | ||
+ | |||
+ | <h3>Composite 2:</h3> | ||
+ | <h4>GSH:Bifunctional gamma-glutamate-cysteine ligase/glutathione synthetase</h4> | ||
+ | |||
+ | <p> | ||
+ | Reactive Oxygen Species (ROS) are dangerous substances that distort protein based matters by taking electrons (Lu, 2013). The chemical structure of the protein-based | ||
+ | substances are altered and become dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011). | ||
+ | </p> | ||
+ | |||
+ | <p> | ||
+ | Furthermore, one of the most significant protein-based substance, DNA, gets attacked by OH radicals (Burton & Jauniaux, 2011). However, the reduced form GSH can protect | ||
+ | the chemical structure of the proteins by giving extra electrons to the ROS and free radicals (Lu, 2013). This is accomplished by GSH peroxidase-catalyzed reactions | ||
+ | (Lu, 2013). | ||
+ | </p> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2018/7/70/T--METU_HS_Ankara--cparts0121566.jpg" /> | ||
+ | |||
+ | <img width="500" src="https://static.igem.org/mediawiki/2018/c/cd/T--METU_HS_Ankara--cparts08.gif" /> | ||
+ | <br> | ||
+ | <i style="font-size: 12px"> | ||
+ | Figure 6: 3D protein structure of Bifunctional gamma-glutamate-cysteine ligase | ||
+ | </i> | ||
+ | |||
+ | <h5>Our circuit design for GSH gene</h5> | ||
+ | |||
+ | <p> | ||
+ | Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), GSH as protein coding region, double terminator (B0015) and suffix. This part enables our E. | ||
+ | coli KO11 strain to overexpress oxidised Glutathione to reduce oxidative stress, increasing its lifespan. (Lu, 2013) Our construct is inserted into pSB1C3 and | ||
+ | delivered to the Registry. | ||
+ | </p> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2018/b/b4/T--METU_HS_Ankara--cparts09.jpg" /> | ||
+ | <br> | ||
+ | <i style="font-size: 12px"> | ||
+ | Figure 7: Circuit design of Composite part 2 with GSH gene. <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">BBa_K2571005</a>. Our construct | ||
+ | includes a strong promoter, RBS, GSH and double terminator. | ||
+ | </i> | ||
+ | |||
+ | <p> | ||
+ | In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting the amino acid | ||
+ | sequence. We looked through the codon bias property of E.coli and made the nucleotide changes accordingly. | ||
+ | </p> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2018/8/87/T--METU_HS_Ankara--cparts012566.jpg" /> | ||
+ | <br> | ||
+ | <i style="font-size: 12px"> | ||
+ | Figure 8: Because Glutathione prevents the ROS from harming the bacteria, in high glutathione concentration increase in cell mass was observed. In brief, when | ||
+ | glutathione concentration increases, the specific cell growth rate also increases and we observe increase in number of bacteria compared to the bacteria without | ||
+ | GSH gene (Kim & Hahn , 2013). | ||
+ | </i> | ||
+ | |||
+ | <div class="col-md-6"> | ||
+ | <img src="https://static.igem.org/mediawiki/2018/9/9d/T--METU_HS_Ankara--cparts01256eeie6.jpg" /> | ||
+ | <br> | ||
+ | <i style="font-size: 12px"> | ||
+ | Figure 9: <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">BBa_K2571005</a> check with GSH specific primers. Expected band length: 225 bp. | ||
+ | Last six wells show positive results. | ||
+ | </i> | ||
+ | </div> | ||
+ | |||
+ | <div class="col-md-6"> | ||
+ | <p> | ||
+ | We’ve inserted the GSH composite part to pSB1C3 backbone. Then, we’ve transformed the construct for submission, | ||
+ | <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">BBa_K2571005</a>, (in pSB1C3) | ||
+ | to Dh4 alpha and conducted colony PCR. We’ve made the PCR with GSH specific primers and expected to see a result of 225bp. By showing the | ||
+ | band we expected, 225bp, PCR confirmation for our insertion proved right. | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div style="clear: both"></div> | ||
+ | <p> | ||
+ | GSH left and right primers are shown as below: | ||
+ | <br > | ||
+ | GSH left: TCGGAGGCTAAAACTCAGGA | ||
+ | <br > | ||
+ | GSH right: GTGGGCAGTCCAGTCGTAAT | ||
+ | </p> | ||
+ | |||
+ | <h3>Composite 3:</h3> | ||
+ | <h4>Dual Expression of FucO and GSH</h4> | ||
+ | |||
+ | <p> | ||
+ | The first protein coding region we have, placed after the RBS, FucO, will code for L-1,2-propanediol oxidoreductase (a homodimer enzyme) | ||
+ | in order to act upon furfural presence in the field (Zheng, 2013). The metabolism of furfural by NAD(P)H-dependent oxidoreductases will | ||
+ | reduce the toxicity of the chemical by turning it into furfuryl alcohol, a derivative and increase the furfural tolerance (Zheng, 2013; | ||
+ | Wang et al., 2013; Allen et al., 2010). Our second protein coding region, bifunctional gamma-glutamate-cysteine ligase/glutathione | ||
+ | synthetase (GSH), is a non-protein thiol group and a tripeptide composed of cysteine, glycine and glutamic acid (Lu, 2013). It is crucial | ||
+ | for the detoxification of reactive oxygen species and free radicals (Ask et al, 2013). Reactive oxygen species (ROS) are harmful substances | ||
+ | that alter protein based matters by taking electrons (Lu, 2013; Burton & Jauniaux, 2011). Because many benefits of GSH include scavenging | ||
+ | of ROS, protection against endogenous toxic metabolites and detoxification of xenobiotics, we choose this gene to entagrate with the FucO | ||
+ | (Höck et al., 2013). Thus we constructed multi functional gene providing long life span and resistance. | ||
+ | </p> | ||
+ | |||
+ | <h4>Design Notes of Dual Expression of FucO and GSH <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571006">(BBa_K2571006)</a></h4> | ||
+ | |||
+ | <p> | ||
+ | Our construct for composite part 3 is composed of two stages, first the reduction of furans (specifically furfural and 5-HMF) and second the | ||
+ | detoxification of reactive oxygen species (ROS).-To achieve this effect, we designed our composite 3 part as with a prefix, a strong promoter | ||
+ | (J23100), RBS (B0034), fucO as the first protein coding region <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571003">(BBa_K2571003)</a>, | ||
+ | RBS (B0034), GSH as the second protein coding region <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571005">(BBa_K2571005)</a>, | ||
+ | double terminator (B0015) and suffix. | ||
+ | </p> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2018/d/dc/T--METU_HS_Ankara--cparts01256eie6.jpg" /> | ||
+ | <br> | ||
+ | <i style="font-size: 12px"> | ||
+ | Figure 10: Circuit design of Composite part 3 with FucO and GSH genes. <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2571006">BBa_K2571006</a>. | ||
+ | Our construct includes a strong promoter, RBS, FucO, RBS, GSH and double terminator. | ||
+ | </i> | ||
+ | |||
+ | <p> | ||
+ | Our construct is inserted into pSB1C3 and delivered to the Registry. Our construct is also inserted into pSB1A3 and transferred into KO11 to | ||
+ | conduct further biochemical assays. | ||
+ | </p> | ||
+ | |||
+ | <p> | ||
+ | Given that fucO is NADH-dependent it outperforms other oxidoreductases, by not interfering with the NADPH metabolism of the organism while converting highly | ||
+ | toxic substances, furfural and 5-HMF to non-harmful alcohols. This characteristic of fucO is crucial because the expression of oxidoreductases like Yqhd are | ||
+ | NADPH-dependent, hence they compete with the biosynthesis for NADPH, which results in inhibiting the growth of the organism. | ||
+ | </p> | ||
+ | |||
+ | <p> | ||
+ | Glutathione, on the other hand, is recycled using NAD(P)H pathways and since now it will be overexpressed and with NADH metabolism is not being altered thanks | ||
+ | to FucO, antioxidant capacity of the cell will be increased dramatically, result in amplified immunity to both furans and ROS, habilitating cell growth, | ||
+ | increasing ethanol yield by the virtue of increasing cell mass and reproduction, and improved metabolism. | ||
+ | </p> | ||
+ | |||
+ | |||
+ | <section class="ct-u-paddingTop50 ct-u-paddingBottom80 ct-u-borderBoth ct-u-backgroundGray"> | ||
+ | <div class="container"> | ||
+ | <div class="row"> | ||
+ | <div class="col-md-12"> | ||
+ | <div class="panel-group" id="accordion"> | ||
+ | <div class="panel panel-default"> | ||
+ | <div class="panel-heading"> | ||
+ | <h4 class="panel-title"> | ||
+ | <a data-toggle="collapse" data-parent="#accordion" href="#collapseOne"> | ||
+ | References | ||
+ | </a> | ||
+ | </h4> | ||
+ | </div> | ||
+ | <div id="collapseOne" class="panel-collapse collapse"> | ||
+ | <div class="panel-body"> | ||
+ | <ul> | ||
+ | <li> | ||
+ | Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., … Gorsich, S. W. (2010). | ||
+ | Furfural induces reactive oxygen species accumulation and cellular damage in Saccharomyces cerevisiae. | ||
+ | Biotechnology for Biofuels, 3, 2. http://doi.org/10.1186/1754-6834-3-2 | ||
+ | </li> | ||
+ | </ul> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | |||
+ | </div> | ||
+ | </section> | ||
</html> | </html> | ||
+ | |||
+ | {{METU_HS_Ankara/footer}} |
Revision as of 19:55, 1 October 2018