Team:UI Indonesia/Parts
AFFITOXIN
Using the wild-type diphtheria exotoxin to characterize HBEGF-TAR receptor could be harmful due to biosafety reason. To tackle this problem, our team design a much simplified diphtheria toxin by removing the domain that is deadly to the cell. This domain, named domain C, will be translocated into the cell with the aid of other domains in toxin called domain R and domain T. Additionally, R domain recognized the natural HBEGF receptor, and T domain will insert the C domain into the cell. Thus, C domain would catalyze NAD-dependent ADP-ribosylation of EF-2 and leads to cellular apoptosis1. This remodeled toxin, coined Affitoxin, is incorporated in the plasmids (such as pSB1C3 and pEQ80L) along with the following parts.
Figure 1. Affitoxin Biobrick.
Amplification of single biobrick are done via PCR cloning using ‘self-made’ universal forward (Primer Cloning Fwd) and reverse primers (Primer Cloning Rev). The following sequences are the primers for PCR cloning.
- PCR cloning primer forward : 5’ AGTTCAAGTGTCCGAGAA 3’
Specifications:
- Melting Temperature (Tm) : 60.2oC
- GC content : 44.4%
- Hairpin structure energy formation : 0.64 kcal/mol
- Self-dimer energy formation : -3.61 kcal/mol
- PCR cloning primer reverse : 5’ TAAGCGAGTGCCGTATTA 3’
Specifications:
- Melting Temperature (Tm) : 60.1oC
- GC content : 44.4%
- Hairpin structure energy formation : -1.36 kcal/mol
- Self-dimer energy formation : -3.61 kcal/mol
Note: Both heterodimer energy formations are -3.61 kcal/mol. Additionally, the predicted specifications are based on IDT Oligo Analyzer 3.1 server (https://sg.idtdna.com/calc/analyzer) PCR solution is predicted to contain 0.2 mM dNTP, 50 mM Na+, 5 mM Mg2+, and 0.3 mM oligos.
Specifications:
- Melting Temperature (Tm) : 60.2oC
- GC content : 44.4%
- Hairpin structure energy formation : 0.64 kcal/mol
- Self-dimer energy formation : -3.61 kcal/mol
Specifications:
- Melting Temperature (Tm) : 60.1oC
- GC content : 44.4%
- Hairpin structure energy formation : -1.36 kcal/mol
- Self-dimer energy formation : -3.61 kcal/mol
Confirmation of gBlocks insertion into plasmid could be confirmed using PCR colony method using following primer. Note that HbT1 Fwd and HbT2 Rev is the same primer used in HT fragments to do PCR colony in Affitoxin gBlocks.
- Primer HbT1 Fwd : 5’ CTTACGCTTCTGCCACAT 3’
Specifications:
- Melting Temperature (Tm) : 61.7oC
- GC content : 50%
- Hairpin structure energy formation : -0.84 kcal/mol
- Self-dimer energy formation : -3.61 kcal/mol
- Primer HbT2 rev : 5’ CCCCTGACTGAGCATGAT 3’
Specifications:
- Melting Temperature (Tm) : 62.8oC
- GC content : 55.6%
- Hairpin structure energy formation : 0.57 kcal/mol
- Self-dimer energy formation : -5.38 kcal/mol
Note: Both heterodimer energy formation exhibits -5.04 kcal/mol free energy.
Specifications:
- Melting Temperature (Tm) : 61.7oC
- GC content : 50%
- Hairpin structure energy formation : -0.84 kcal/mol
- Self-dimer energy formation : -3.61 kcal/mol
Specifications:
- Melting Temperature (Tm) : 62.8oC
- GC content : 55.6%
- Hairpin structure energy formation : 0.57 kcal/mol
- Self-dimer energy formation : -5.38 kcal/mol
For iGEM biobrick submission, we would use prefix and suffix that contain EcoRI and PstI. HindIII site and BamHI are inserted upstream from prefix and downstream from suffix respectively. The Affitoxin contains only the last 54 amino acid from the R domain which has no cytotoxicity and significant enough to bind with HBEGF receptor.2 At the downstream of the sequence, designing six histidine amino acids is essential for His-tag protein purification, as well as characterizing the affitoxin and HBEGF-TAR receptor kinetics. Ribosome Binding Site (RBS) is located upstream within the gBlocks containing Shine-Dalgarno sequence as follow.
RBS : 5' GAGCGGATTATATAAGGAGGTTAATC 3’
HBEGF-TAR