Team:Newcastle/Results/Operon

Alternative Roots/Design

Alternative Roots

Naringenin Operon Assembly Results

Results

Introduction

Guided by the successful chemotaxis results, proving that 50µM naringenin attracts the nitrogen fixing bacteria A. brasilense and H. seropedicae, we aimed to engineer a naturally colonising endophyte Pseudomonas sp. (CT 364) to produce naringenin. For proof of concept the production of naringenin would first need to be demonstrated in E. coli before being tested in Pseudomonas sp., our final chassis organism.

Naringenin biosynthesis is achieved through the expression of an operon containing four genes encoding the enzymes that constitute the naringenin biosynthetic pathway (Figure 1). This operon was previously assembled and submitted to the iGEM registry by TU Darmstadt 2014 iGEM team BBa_K1497016 and is a composite of the following four genes, each with the strong RBS (BBa_B0034):

    4-Coumaryl ligase - 4CL (BBa_K1033001)
    Tyrosine ammonia lyase - TAL (BBa_K1033000)
    Chalcone isomerase - CHI (BBa_K1497000)
    Chalcone synthase - CHS (BBa_K1497001)
We decided to optimise the sequence for the enzyme tyrosine ammonia lyase by reducing the G/C content so that it could be synthesised by IDT. The entire operon was synthesised in four separate parts referred to as gBlocks that were subsequently used for Gibson Assembly, as this was how TU Darmstadt assembled their operon successfully. Moreover this assembly does not leave restriction site scars due to the overlapping fragments. Instead of using Pseudomonas sp. it was deemed logical to use E. coli DH5α during the cloning experiments as we had a greater understanding of its transformation. Using this as a proof of concept would allow us to carry out a preliminary screening for naringenin production before attempting to transform our endophyte.

Alongside this, in an attempt to optimise naringenin production, a new design of the naringenin operon was made in Benchling. This was based on the pathway modelling results and was constructed to show how BG28 and BG51 dual E. coli-Pseudomonas promoters with a 10-fold difference in strength could increase naringenin production.


Figure 1: The naringenin synthesis pathway from L-tyrosine.

Results

Operon and Plasmid Design

Plasmid Design

The initial plasmid design for naringenin biosynthesis was based on TU Darmstadt’s design but with a codon optimised tyrosine ammonia lyase. We used pSB1C3 as a backbone, into which we would clone each of the four necessary genes downstream of a strong ribosome binding site (BBa_B0034). This construct was under the control of a strong Anderson promoter (J23100) to allow for constitutive expression of the operon (Figure 2). Once biosynthesis under the control of J23100 is achieved,  future experiments will test this under the strong constitutive T7 promoter in E. coli (Figure 3). Parts for biosynthesis in root-colonising Pseudomonas sp., will be implemented into a plasmid backbone more suitable for its uptake.


Figure 2:The naringenin biosynthetic operon under control of a J23100 promoter created in Benchling.


Figure 3:The naringenin biosynthetic operon under control of a T7 promoter created in Benchling.


Figure 4:The naringenin biosynthetic operon construct under control of a J23100 promoter created in SBOL.


Figure 5: The naringenin biosynthetic operon contruct under control of a T7 promoter created in SBOL.

Naringenin pathway modelling influenced design

Results of the naringenin pathway modelling demonstrated that weaker expression of the first two genes and 10-fold stronger expression of the last two genes would reduce the build-up of malonyl CoA and optimise naringenin synthesis. As a result of this, two synthetic promoters (BG28 and BG51) (Figure 7) were selected and an additional E. coli his operon terminator that was placed after the first two genes (Figure 6). These changes to the operon design could allow enhanced naringenin production in future experiments. More information about the pathway can be found here.


Figure 6:The naringenin biosynthetic operon under control of synthetic promoters BG28 and BG51 created in Benchling.


Figure 7: A close up of the synthetic promoters BG28 and BG51 placement in the operon, created in Benchling.


Figure 8: The naringenin biosynthetic operon contruct under control of a BG28 and BG51 promoters and an additional his operon terminator created in SBOL.

Primers were designed for amplification of the backbone and the 4 gBlocks (Table 1). These were designed in Benchling. The primers were used to prevent running out of the gBlocks synthesised by IDT and to detect the specific genes from the operon that could be present in transformed cells.

Table 1: Primers designed in Benchling for amplification of the 4 gblocks and the pSB1C3 backbone.

Primer name Sequence Tm Ta Q5 Amplified product(bp) Shown to work Description
pSB1C3F tactagtagcggccgctgc 70 71 2070 6/8/18 To amplify pSB1C3 backbone
pSB1C3R ctctagaagcggccgcga 70 71 2070 6/8/18 To amplify pSB1C3 backbone
4CLF ccaaatcgccgccaattttc 59 56 1686 6/9/18 To amplify 4CL part
4CLR cgtcgtcgttttgaagtggt 59.07 56 1686 28/9/18 To amplify 4CL part
TALF gaatgtccgaacgctacagg 58.72 55 1649 28/9/18 To amplify TAL part
TALR tcggaattgagcaggtcgat 59.18 56 1649 28/9/18 To amplify TAL part
CHIF ctgggcatagaggtctggag 58.95 56 726 28/9/18 To amplify CHI part
CHIR caccttctccgagtactgct 58.82 56 726 28/9/18 To amplify CHI part
CHSF aagacgtgcctgggttgata 59.02 56 1197 28/9/18 To amplify CHS part
CHSR gcttctcctccttcaaccct 59.01 56 1197 6/9/18 To amplify CHS part
gb1F ctggaattcgcggccgct 72 54 1686 20/9/18 To amplify 4CL part
gb1R ttacaatccatttgctag 53 54 1686 20/9/18 To amplify 4CL part
gb2F ggcaaaactagcaaatgg 59 59 1649 20/9/18 To amplify TAL part
gb2R ttatcagacgggagattg 58 59 1649 20/9/18 To amplify TAL part
gb3F cttgcagcaatctcccgt 65 59 726 20/9/18 To amplify CHI part
gb3R ctagactccaatcactgg 58 59 726 20/9/18 To amplify CHI part
gb4F tactattccagtgattgg 54 55 1197 20/9/18 To amplify CHS part
gb4R cggactgcagcggccgct 78 55 1197 20/9/18 To amplify CHS part

Results

Experimental Work

Backbone amplification

The pSB1C3 backbone was amplified, purified and quantified in preparation for Gibson assembly of the naringenin operon. Amplification was performed by PCR using Q5 ® High-Fidelity DNA Polymerase and primers pSB1C3F and pSB1C3R. The resultant PCR product was analysed by agarose gel electrophoresis and showed a band at 2kb that corresponded to the size of the plasmid. The backbone was then purified using Qiagen QIAquick PCR Purification Kit. The DNA concentration was quantified using a Qubit fluorometer and was determined to be 3.58 µg/ml. As this concentration was far too low for Gibson assembly the backbone was amplified and purified again using the same techniques resulting in a brighter band at 2kb than before (Figure 9) and a stock concentration of 26.2 µg/ml.

Protocol Details found here


Figure 9: Agarose gel showing the 2 kb band representing the amplified plasmid backbone, Bioline HyperLadderTM 1 kb is shown that was used for subsequent gel analysis.

Gibson Assemblies

A positive control of the Gibson assembly was conducted. The NEBuilder® HiFi DNA Assembly Cloning Kit was used. A positive control reagent supplied with the kit contained two overlapping dsDNA fragments and the pUC19 plasmid. The positive control was conducted to check the assembly mix was working, the protocols for transformation were correct and that the cells prepared previously were competent.

The results of the positive control showed that the E. coli DH5α cells had successfully been made competent as they were able to take up the three-part assembly of the two overlapping fragments and the pUC19 backbone (Figure 10). Furthermore the reagents and protocols used in the Gibson assemblies were shown to have worked proving their viability for use in future experiments. No colonies grew on the negative control plates (Figure 10), verifying that E. coli DH5α cells are not ordinarily resistant to amplicillin and that no contamination had occurred.


Figure 10: LB ampicillin positive control plate containing colonies from transformed cells and negative control plates with un-transformed DH5α cells.

Results

Conclusions

Two colonies from Gibson transformations resulted in a 7kb band, corresponding to the size of the operon and plasmid backbone. However sequencing was inconclusive therefore this operon could not be classified as a working part. Future experimentation should attempt to assemble the gblocks one by one into the plasmid backbone and gain sequencing results that show full alignment. Following this the 7kb plasmid should be transformed into BL21 expression cells to produce naringenin, to be extracted using ethyl acetate and measured through HPLC. HPLC of stock naringenin should be conducted for comparison. Observing the expression of the operon using T7 promoters instead of the J23100 constitutive promoter, to see if naringenin production is enhanced. This could be implemented using T7 primers and Q5 site directed mutagenesis in E. coli.