Team:HKJS S/Collaborations
Collaborations
After our
discussion with the HKUST team, we attempt to optimize the Gibson
Assembly used to inserted OmpA gene into
the desired plasmid.
Our
design to attempt restriction enzyme digestion before we insert the OmpA gene into the plasmids. This can lower the
difficulty for PCR amplification as some suggested that if the
primers are too close to each other during a circular DNA amplification, it
increases the difficulty. As Suggested, routine linearization of plasmid DNA
increases the efficiency of PCR amplification
as PCR amplification works optimal with relaxed DNA. Hence, we choose
to linearize the plasmids before the Laccase and after the
Ribosome Binding site using BseRI. Learning from
the Nitrogenase Gibson Assembly in our project, which we constructed
overlapping region on all fragments, we choose to construct all
overlapping regions before Gibson Assembly in this design. This ensure the
assembly is specific and prevent frameshift.
On the
other hand, HKUST team helped us with the SDS-PAGE, characterizing
our PETase. As the HKUST team is more
experienced with protein extraction, we offered them PETase constructs,
which are inserted to pETBlue-2 and pSB1C3, and the
result returned is positive, showing that the NEB 5 Alpha strain managed to
express the protein in both pETBlue-2 and pSB1C3.
The
Collaboration between HKUST team and our team have improved the
quality of both teams’ project.
Gibson Assembly
1. Digest Plasmid with Bseri
BseRI
Steps
1.
Set up reaction as follows:
|
COMPONENT |
50 µl REACTION |
|
DNA |
1 µg |
|
10X CutSmart
Buffer |
5 µl (1X) |
|
BseRI |
1.0 µl (or 10 units) |
|
Nuclease-free Water |
to 50 µl |
2.
Incubate at 37°C for 5–15 minutes as BseRI is
Time-Saver qualified.
Please refer tohttps://nebcloner.neb.com/#!/protocol/re/single/BseRI
2. PCR to remove the excess basepair on the plasmid
To ensure that all protein coding sequence is in frame to the T7 promoter.
|
pSB1c3_For |
AGGGAGCTCGTGATGCAACGTCGT |
|
pSB1c3_ Rev |
AGTAGCTTTCATATGTCTAGTATTTCTCCTCTTTCTC |
Annealing temp :68℃
Add 5μL of Q5® High GC Enhancer
3. PCR to add overlapping complementary basepair ON OMPA sequence
base pair complementary to
the plasmid is added to both the beginning and the end of the OMPA sequence for
subsequent Gibson Assembly.
|
OMPA_For |
AGAAATACTAGACATATGAAAGCTACTAAACTGGTACTGGG |
|
OMPA_Rev |
CGACGTTGCATCACGAGCTCCCTCCTCCAG |
Annealing temp :71℃
Add 5μL of Q5® High GC Enhancer
4. Perform gibson assembly to insert OMPA
Standard Gibson Assembly
Please
refer to Gibson Assembly from https://www.neb.com/-/media/catalog/datacards-or-manuals/manuale2611.pdf