|
|
| (18 intermediate revisions by 2 users not shown) |
| Line 1: |
Line 1: |
| | + | {{BNU-CHINA/partials/header}} |
| | + | {{BNU-CHINA/partials/nav | MODELING=focus}} |
| | + | {{BNU-CHINA/article/theme | color=#8c531b}} |
| | | | |
| − | <!--[if lt IE 8 ]><html class="no-js ie ie7" lang="en"> <![endif]-->
| + | <html> |
| − | <!--[if IE 8 ]><html class="no-js ie ie8" lang="en"> <![endif]--> | + | <div class="main-container"> |
| − | <!--[if (gte IE 8)|!(IE)]><!-->
| + | <div id="page-heading" class="container-fluid page-heading" style="background-image: url(https://static.igem.org/mediawiki/2016/0/0b/T--BNU-China--rabbit.jpg);"> |
| − | <html class="no-js" lang="en">
| + | <h3> Interlab </h3> |
| − | <!--<![endif]--> | + | </div> |
| − | <head>
| + | <div> |
| − | <!--- Basic Page Needs========================================================================= -->
| + | <div class="page-story"> |
| − | <meta charset="utf-8"/>
| + | <article id="Calibration" class="col-lg-10 col-lg-offset-1 col-md-12 col-md-offset-0 col-sm-offset-0 col-sm-12"> |
| − | <title>Proof</title>
| + | <header class="page-header"> |
| − | <meta name="viewport" content="width=device-width, initial-scale=1.0, maximum-scale=1.2, user-scalable=yes" />
| + | <h1 id="model-introduction">Calibration experiments</h1> |
| − | <meta name="description" content="Wiki of Peking iGEM 2016" />
| + | </header> |
| − | <meta name="author" content="Li Jiamian & Wang Yuqing"/>
| + | <p>Before starting cell measurements work, we accomplished three sets of calibration measurements with materials provided by the committee, including an OD600 reference point, a particle standard curve and a fluorenscein standard curve. These tests and data greatly facilitated our following quantitative interlab experiments.</p> |
| − | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
| + | |
| − | <!-- Mobile Specific Metas===================================================================== -->
| + | |
| − | <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1"/>
| + | <h2>Calibration 1 OD600 reference point and LUDOX</h2> |
| − | <!-- Fix Overwrite the original iGEM style=================================================== -->
| + | <p>According to the protocol, we performed three calibration experiments (OD600 reference point, particle standard curve and the fluorescence standard curve) before the body part began.</p> |
| − | <link href="https://2016.igem.org/Template:Peking/css/fix?action=raw&ctype=text/css" rel="stylesheet" />
| + | <p>In this experiment, we first uesd LUDOX CL-X provided by the committee to obtain a conversion factor as the intermediate variable between Abs600 and OD600 measurement. The LUDOX solution (45% colloidal silica suspension) is hardly scattering and gives a low absorbance value, making it an ideal material for correct the standard path length of spectrophotometers in different laboratories, which would greatly improve the accuracy of the following volume dependent experiments.</p> |
| − | <!-- CSS======================================================================================= -->
| + | <p>Results shown below. </p> |
| − | <link href="https://2016.igem.org/Template:Peking/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet" />
| + | <figure class="text-center"> |
| − | <link href="https://2016.igem.org/Template:Peking/css/style?action=raw&ctype=text/css" rel="stylesheet" /> | + | <img src="https://static.igem.org/mediawiki/2016/e/e9/Modeling_steps.png" alt="this is a pic" width="60%"> |
| − | <!-- CSS======================================================================================= -->
| + | <figcaption> |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/default?action=raw&ctype=text/css"/>
| + | Table 1. OD600 reference point |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/layout?action=raw&ctype=text/css"/>
| + | </figcaption> |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/media-queries?action=raw&ctype=text/css"/> | + | </figure> |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/priorstyle?action=raw&ctype=text/css"/>
| + | <p id="model-theory">4 replicates are measured respectively to acquire the average Abs600 of LUDOX CL-X solution and dH2O. Reference OD600 is given by the iGEM authority. The ratio of OD600/Abs600 is 3.652.</p> |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/notebook_panel?action=raw&ctype=text/css"/>
| + | |
| − | <style>
| + | |
| − | .texttitle{
| + | <h2>Calibration 2 Particle Standard Curve</h2> |
| − | color: #11abb0;
| + | <p>After standardizing the absorbance value, we managed to conclude a conversion factor between Abs600 and the estimated number of cells. In this experiment, we used the silica beads delivered by iGEM committee and made a serial dilution in the 96-well plate according to the protocol. The beads’ size and optical charateristics are similar to cells and its concentration (amount of particles per volume)is known, allowing us to conduct a standard curve of particle concentration in 4 replicates. Origin data presented at the bottom of this page.</p> |
| − | font-size: 38px;
| + | <figure class="text-center"> |
| − | line-height: 48px;
| + | <img src="https://static.igem.org/mediawiki/2016/e/e9/Modeling_steps.png" alt="this is a pic" width="60%"> |
| − | margin-bottom: 12px;
| + | <figcaption> |
| − | font-family: raleway-bold, sans-serif !important;
| + | Figure 1A Particle Standard Curve |
| − | background: transparent;
| + | </figcaption> |
| − | letter-spacing: 3px;
| + | </figure> |
| − | text-transform: uppercase;
| + | <figure class="text-center"> |
| − | font-weight: 350;
| + | <img src="https://static.igem.org/mediawiki/2016/e/e9/Modeling_steps.png" alt="this is a pic" width="60%"> |
| − | text-align: center;
| + | <figcaption> |
| − | }
| + | Figure 1B Particle Standard Curve (log scale) |
| − | sup{font-size:11px;}
| + | </figcaption> |
| − | .references{margin-top:150px;margin-bottom:40px;}
| + | </figure> |
| − | .references p{font-size:14px !important; color:#666161 !important;}
| + | |
| − | .classic-title {font-weight: 300;}
| + | <h2>Calibration 3 Fluorescence standard curve</h2> |
| − | .classic-title span {
| + | <p>Fluorescence value is an important synthetic biology signal, but it can vary widely in different instruments. As a result, comparing the fluorescence output of test devices by creating a standard fluorescence curve can accurately standardize the amount and fluctuation of GFP fluorescencein in provided kits. In the fluorescence curve measurement, we used the fluorescein powder delivered by committee and made a serial dilution in the 96-well plate according to the protocol. 4 replicates were measured in total. Origin data presented at the bottom of this page.</p> |
| − | padding-bottom: 8px;
| + | <figure class="text-center"> |
| − | border-bottom: 1px solid #383232;
| + | <img src="https://static.igem.org/mediawiki/2016/e/e9/Modeling_steps.png" alt="this is a pic" width="60%"> |
| − | font-weight: 400;
| + | <figcaption> |
| − | }
| + | Figure 2A Fluorescein Standard Curve |
| − | figure{margin-top:40px;margin-bottom:40px;height:auto;}
| + | </figcaption> |
| − | .anchor{padding-top:100px;margin-top:-100px;}
| + | </figure> |
| − | </style>
| + | <figure class="text-center"> |
| − |
| + | <img src="https://static.igem.org/mediawiki/2016/e/e9/Modeling_steps.png" alt="this is a pic" width="60%"> |
| − | </head>
| + | <figcaption> |
| − |
| + | Figure 2B Fluorescein Standard Curve(log scale) |
| − |
| + | </figcaption> |
| − |
| + | </figure> |
| − | <body>
| + | </article> |
| − |
| + | |
| − | <!-- Navigation -->
| + | |
| − | <div id="navigation" class="navbar navbar-fixed-top">
| + | |
| − | <div class="navbar-inner ">
| + | |
| − | <div class="container no-padding"> | + | |
| − | <a class="show-menu" data-toggle="collapse" data-target=".nav-collapse"><span class="show-menu-bar"></span>
| + | |
| − | </a>
| + | |
| − | <div id="logo" style="max-width:170px"><a class="" href="https://2016.igem.org/Team:Peking"></a></div>
| + | |
| − |
| + | |
| − | <div class="nav-collapse collapse">
| + | |
| − | <ul class="nav">
| + | |
| − | <li class="menu-1"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking" >Home</a></li>
| + | |
| − | <li class="dropdown menu-2"><a class="dropdown-toggle" data-toggle="dropdown" href="#" > Achievements</a>
| + | |
| − | <ul class="dropdown-menu">
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Results" >Results</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Basic_Part" >Parts</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Collaborations" >Collaborations</a></li>
| + | |
| − | </ul>
| + | |
| − | </li>
| + | |
| − | <li class="dropdown menu-3"><a class="dropdown-toggle" data-toggle="dropdown" href="#">Project</a>
| + | |
| − | <ul class="dropdown-menu">
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Description" >Overview</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Design" >Design</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Crosslinking" >Crosslinking</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Uranyl-adsorption" >Uranyl adsorption</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Clearance" >Clearance</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Secretion" >Secretion</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Demonstrate" >Final Performance</a></li>
| + | |
| − | </ul>
| + | |
| − | </li>
| + | |
| − | <li class="dropdown menu-4"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Modeling</a>
| + | |
| − | <ul class="dropdown-menu">
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Model/GelPoint" > Model of Gel Point </a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Model/MassDistribution" > Model of Mass Distribution</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/Software" >Software</a></li>
| + | |
| − | </ul>
| + | |
| − | </li>
| + | |
| − | <li class="dropdown menu-5"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Practices</a>
| + | |
| − | <ul class="dropdown-menu">
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/HP/Gold" >Overview</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/HP/311" >Field research</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/HP/questionnaire" >Questionnaire</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/HP/consulting" >Consulting</a></li>
| + | |
| − | <li><a href="https://2016.igem.org/Team:Peking/HP/otherHP" >Education & Other</a></li>
| + | |
| − | </ul>
| + | |
| − | </li>
| + | |
| − | <li class="menu-6"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Safety" >Safety</a>
| + | |
| − | <li class="dropdown menu-7"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Lab</a>
| + | |
| − | <ul class="dropdown-menu">
| + | |
| − | <li><a class="" href="https://2016.igem.org/Team:Peking/Team" >Team</a></li>
| + | |
| − | <li><a class="" href="https://2016.igem.org/Team:Peking/Attributions" >Attribution</a></li>
| + | |
| − | <li><a class="" href="https://2016.igem.org/Team:Peking/Notebook" >Notebook</a></li>
| + | |
| − | </ul>
| + | |
| − | </li>
| + | |
| − | <li class="menu-8"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Interlab" >Interlab</a>
| + | |
| − | </li>
| + | |
| − | </div>
| + | |
| − | </div> | + | |
| − | </div> | + | |
| | </div> | | </div> |
| − | <!--/Navigation --> | + | <div id="footer"> |
| | + | <div id="footer-div"> |
| | + | <ul id="footer-ul"> |
| | + | <li><a href="https://2018.igem.org/Team:BNU-China">Home</a></li> |
| | + | <li><a href="https://2018.igem.org/Team:BNU-China/Project">Project</a></li> |
| | + | <li><a href="https://2018.igem.org/Team:BNU-China/Model">Model</a></li> |
| | + | <li><a href="https://2018.igem.org/Team:BNU-China/Achievements">Achievements</a></li> |
| | + | <li><a href="https://2018.igem.org/Team:BNU-China/Integrated_Practices">Practices</a></li> |
| | + | <li><a href="https://2018.igem.org/Team:BNU-China/Safety">Safety</a></li> |
| | + | <li><a href="https://2018.igem.org/Team:BNU-China/Lab">Lab</a></li> |
| | + | <li><a href="https://2018.igem.org/Team:BNU-China/Interlab">Interlab</a></li> |
| | + | </ul> |
| | + | <span>© 2018 BNU</span> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | | | |
| − | | + | </html> |
| − | | + | |
| − | | + | |
| − | <!-- Page Title======================================================================== -->
| + | |
| − | <div id="page-title">
| + | |
| − | <div class="row">
| + | |
| − | <div class="twelve columns centered text-center">
| + | |
| − | <h1>Interlab</h1>
| + | |
| − | <p class="title1" style="text-align:center">The Peking iGEM 2016 team is participating in the third year of the iGEM Interlab study along with about 100 teams. We focused on quantifying expression of GFP in common, comparable or absolute units. </p>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | <!-- Page Title End-->
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | <style type="text/css">
| + | |
| − | .texttitle{
| + | |
| − | color: #11abb0;
| + | |
| − | font-size: 38px;
| + | |
| − | line-height: 48px;
| + | |
| − | margin-bottom: 12px;
| + | |
| − | font-family: raleway-bold, sans-serif;
| + | |
| − | background: transparent;
| + | |
| − | letter-spacing: 3px;
| + | |
| − | text-transform: uppercase;
| + | |
| − | font-weight: 350;
| + | |
| − | text-align: center;
| + | |
| − | }
| + | |
| − | #primary span{
| + | |
| − | display:block;
| + | |
| − | word-break:break-all
| + | |
| − | }
| + | |
| − | | + | |
| − | #page-wrap {
| + | |
| − | width: 25%;
| + | |
| − | margin: 0px;
| + | |
| − | position: relative;
| + | |
| − | }
| + | |
| − | | + | |
| − | #sidebar {
| + | |
| − | width: 25%;
| + | |
| − | margin-left: 0px;
| + | |
| − | }
| + | |
| − | @media (min-width:1024px){
| + | |
| − | #sidebar{position:relative;top:120px;max-width:200px;}}
| + | |
| − | @media (max-width: 1023px){
| + | |
| − | #sidebar{display:none;
| + | |
| − | }
| + | |
| − | #page-wrap{display:none;}
| + | |
| − | }
| + | |
| − | | + | |
| − | .classic-title {
| + | |
| − | margin-bottom: 16px;
| + | |
| − | border-bottom: 1px solid #eee;
| + | |
| − | font-weight: 300;
| + | |
| − | margin-
| + | |
| − | }
| + | |
| − | | + | |
| − | | + | |
| − | .classic-title span {
| + | |
| − | padding-bottom: 8px;
| + | |
| − | border-bottom: 1px solid #383232;
| + | |
| − | font-weight: 400;
| + | |
| − | }
| + | |
| − | | + | |
| − | .p > small{
| + | |
| − | margin-bottom:5px;
| + | |
| − | }
| + | |
| − | .texttext h4{
| + | |
| − | margin-top:50px;
| + | |
| − | }
| + | |
| − | </style>
| + | |
| − | | + | |
| − | | + | |
| − | <script type="text/javascript">
| + | |
| − | | + | |
| − | | + | |
| − | function menuFixed(id){
| + | |
| − | var obj = document.getElementById(id);
| + | |
| − | var _getHeight = obj.offsetTop;
| + | |
| − | | + | |
| − | window.onscroll = function(){
| + | |
| − | changePos(id,_getHeight);
| + | |
| − | }
| + | |
| − | }
| + | |
| − | function changePos(id,height){
| + | |
| − | var obj = document.getElementById(id);var windowBottom = $(window).scrollTop() + $(window).innerHeight();
| + | |
| − | if(w>=1024){
| + | |
| − | if($(window).scrollTop() + $(window).height() > $(document).height() - 230){
| + | |
| − | $('#sidebar').fadeOut("fast");}else{$('#sidebar').fadeIn("fast");}
| + | |
| − | }
| + | |
| − | var scrollTop = document.documentElement.scrollTop || document.body.scrollTop -230;
| + | |
| − | var windowBottom = $(window).scrollTop() + $(window).innerHeight();
| + | |
| − | var w = window.innerWidth;
| + | |
| − | | + | |
| − | if(scrollTop < height){ obj.style.position = 'relative';
| + | |
| − | }else{
| + | |
| − | obj.style.position = 'fixed';
| + | |
| − | }
| + | |
| − | }
| + | |
| − | </script>
| + | |
| − | | + | |
| − | <script type="text/javascript">
| + | |
| − | window.onload = function(){
| + | |
| − | menuFixed('sidebar');
| + | |
| − | }
| + | |
| − | </script>
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | <div id="page-content" class="row page">
| + | |
| − | <div id="primary" class="twelve columns">
| + | |
| − |
| + | |
| − | <section>
| + | |
| − | <div class="row">
| + | |
| − |
| + | |
| − |
| + | |
| − | <div class="three columns">
| + | |
| − | <div id="page-wrap">
| + | |
| − | <div id="sidebar" style="color:#000000">
| + | |
| − | | + | |
| − | <h4>Introduction</h4>
| + | |
| − | | + | |
| − | <h4>Method</h4>
| + | |
| − | <h4>Results</h4>
| + | |
| − | <ul>
| + | |
| − | <li><a href="#sequencing">Sequencing</a></li>
| + | |
| − | <li><a href="#data">Data</a></li>
| + | |
| − | </ul>
| + | |
| − | <h4>Discussion</h4>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | | + | |
| − |
| + | |
| − | </div>
| + | |
| − |
| + | |
| − | | + | |
| − | <div class="nine columns texttext">
| + | |
| − | <div class="texttitle">Introduction</div>
| + | |
| − | <div>
| + | |
| − | <p>The Measurement Committee is committed to achieving reliable and repeatable measurement. Therefore the interlab study is established, measurements made in different laboratories by measuring the expression of GFP will be no more variable than measurements taken within the same lab.
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − |
| + | |
| − | <div>
| + | |
| − | <p>After several years of hard work, the committee concluded a universal protocol for measuring GFP expression. In recent years, the interlab study aims to improve the protocol and identify and correct the sources of systematic variability as much as possible.
| + | |
| − | </p>
| + | |
| − | <br>
| + | |
| − |
| + | |
| − |
| + | |
| − | | + | |
| − | <div class="texttitle">Method</div>
| + | |
| − | <p>This year’s interlab study aims to reduce a major source of variability during fluorescence measurements: the number of cells in the sample. Normally, we take the Abs600 of a sample as a representation of its cell density, but still many previous studies showed that there was significant lab-to-lab variability(?). Therefore, we followed the protocols delivered by the iGEM authority and carried out this verification.</p>
| + | |
| − | <br>
| + | |
| − | <p>According to the protocol, we performed three calibration experiments (OD600 reference point, particle standard curve and the fluorescence standard curve) before the body part began. Results shown below. </p>
| + | |
| − | <br>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2018/0/06/T--BNU-China--image_interlab_1.jpg">
| + | |
| − | <p style="text-align:center;"><b>Table 1. OD600 reference point</b></p>
| + | |
| − | <br>
| + | |
| − | <p>Plasmids containing promoters and GFP were taken from The 2016 DNA Distribution Kit and all devices were transformed into <i>E. coli</i>. Fluorescence of colonies was checked up under UV light. </p>
| + | |
| − | <p>5 ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.
| + | |
| − | </p>
| + | |
| − | <a id="sequencing"></a>
| + | |
| − | <br>
| + | |
| − | <div class="texttitle">Results</div>
| + | |
| − | <h3 class="classic-title";"><span>Sequencing</span></h3>
| + | |
| − | <p> • Device 1: J23101+I13504<br>
| + | |
| − | • Device 2: J23106+I13504<br>
| + | |
| − | • Device 3: J23117+I13504<br>
| + | |
| − | • Positive Control Device: I20270 in pSB1C3<br>
| + | |
| − | • Negative Control Device: R0040 in pSB1C3 </p>
| + | |
| − | <p>
| + | |
| − | >BBa_J23101 Part-only sequence (35 bp)<br>
| + | |
| − | <span style="padding-left:45px">Tttacagctagctcagtcctaggtattatgctagc</span></p><p>
| + | |
| − | >BBa_J23106 Part-only sequence (35 bp)<br>
| + | |
| − | <span style="padding-left:45px">Tttacggctagctcagtcctaggtatagtgctagc</span></p><p>
| + | |
| − | >BBa_J23117 Part-only sequence (35 bp)<br>
| + | |
| − | <span style="padding-left:45px">Ttgacagctagctcagtcctagggattgtgctagc</span></p><p>
| + | |
| − | >BBa_I13504 Part-only sequence (875 bp)<br>
| + | |
| − | <span style="padding-left:45px">Aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p>
| + | |
| − | >BBa_I20270 Part-only sequence (919 bp)<br>
| + | |
| − | <span style="padding-left:45px">Ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p>
| + | |
| − | >BBa_R0040 Part-only sequence (54 bp)<br>
| + | |
| − | <span style="padding-left:45px">tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac</span>
| + | |
| − | </p></p>
| + | |
| − |
| + | |
| − | <a id="data"></a>
| + | |
| − | <h3 class="classic-title";"><span>Data</span></h3>
| + | |
| − | <h4>OD600 Reference Point</h4>
| + | |
| − | <p><b>Table 1. OD600 Reference Point.</b></p>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/f/f4/T--Peking--image_interlab_3.png">
| + | |
| − | <br>
| + | |
| − | <h4>FITC Standard Curve</h4>
| + | |
| − | <p ><b>Table 2. Data of FITC standard curve.</b></p>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/1/1b/T--Peking--image_interlab_4.png">
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/0/03/T--Peking--image_interlab_5.png">
| + | |
| − | <p ><b>Figure 2. FITC standard curve.</b></p>
| + | |
| − | <br>
| + | |
| − | <h4>Normalization</h4>
| + | |
| − | <p ><b>Table 3. Normalization.</b></p>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/d/db/T--Peking--image_interlab_6.png">
| + | |
| − | <br>
| + | |
| − | <h4>Cell Measurement</h4>
| + | |
| − | <p ><b>Table 4. Raw data of Abs600 measurement.</b></p>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/0/04/T--Peking--image_interlab_7.png">
| + | |
| − | <p ><b>Table 5. Blank subtraction and correction of Abs600 measurement.</b></p>
| + | |
| − |
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | <img src="https://static.igem.org/mediawiki/2016/e/ee/T--Peking--image_interlab_8.png">
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/7/71/T--Peking--image_interlab_9.png">
| + | |
| − | <p ><b>Figure 3. Blank subtraction and correction of Abs600 measurement.</b></p>
| + | |
| − | <p ><b>Table 6. Raw data of fluorescence measurement.</b></p>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/5/52/T--Peking--image_interlab_10.png">
| + | |
| − | <p ><b>Table 7. Blank substraction and correction of fluorescence measurement.</b></p>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/3/32/T--Peking--image_interlab_11.png">
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/6/67/T--Peking--image_interlab_12.png">
| + | |
| − | <p ><b>Figure 4. Blank subtraction and correction of fluorescence measurement.</b></p>
| + | |
| − | <p ><b>Table 8.Raw data of Fl/Abs600.</b></p>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/d/d3/T--Peking--image_interlab_13.png">
| + | |
| − | <p ><b>Table 9. Raw data of average and SD.</b></p>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/a/a1/T--Peking--image_interlab_14.png">
| + | |
| − | <img src="https://static.igem.org/mediawiki/2016/0/07/T--Peking--image_interlab_15.png">
| + | |
| − | <p ><b>Figure 4. Average level of devices.</b></p>
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − |
| + | |
| − | | + | |
| − | <div class="texttitle">Discussion</div>
| + | |
| − | <p>It is noticeable that the promoter of the Device 1 is strongest followed by the promoter of the Device 2 and Device 3.</p>
| + | |
| − | | + | |
| − | <h3 class="classic-title";"><span>Appendix</span></h3>
| + | |
| − | <p>Individuals responsible for conducting InterLab study
| + | |
| − | • Dong Yiming measured the devices.
| + | |
| − | • Li Cheng processed the data.
| + | |
| − | </p>
| + | |
| − |
| + | |
| − | | + | |
| − | | + | |
| − | </div>
| + | |
| − | </div> <!-- row End -->
| + | |
| − |
| + | |
| − |
| + | |
| − | </section> <!-- section end -->
| + | |
| − | </div> <!-- primary end -->
| + | |
| − | </div> <!-- page-content End-->
| + | |
| − | </div> <!-- Content End-->
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | <!-- footer============================================================================== -->
| + | |
| − | <style>
| + | |
| − | footer .copyright span:before {
| + | |
| − | content: "|";
| + | |
| − | padding-left: 10px;
| + | |
| − | padding-right: 12px;
| + | |
| − | color: #b4bbbb;
| + | |
| − | }
| + | |
| − | footer .copyright span:after {
| + | |
| − | content: "|";
| + | |
| − | padding-left: 10px;
| + | |
| − | padding-right: 12px;
| + | |
| − | color: #b4bbbb;
| + | |
| − | }
| + | |
| − | </style>
| + | |
| − | <footer id="page-footer">
| + | |
| − | <div class="row">
| + | |
| − | <div class="twelve columns" >
| + | |
| − | <ul class="copyright">
| + | |
| − | <!--<li>© 2014 Sparrow</li> -->
| + | |
| − | <li><a href="2016.igem.org/Team:Peking">Home</a> <a href="mailto:pkuigem2016@126.com">Contact</a></li>
| + | |
| − | <span> ©2016 PEKING IGEM. All Rights Reserved.</span>
| + | |
| − | <li><a href="http://getbootstrap.com/2.3.2/">Based on Bootstrap</a></li>
| + | |
| − | </ul>
| + | |
| − | </div>
| + | |
| − | <div id="go-top" style="display: block;"><a title="Back to Top" href="#">Go To Top</a></div>
| + | |
| − | </div>
| + | |
| − | </footer> <!-- Footer End-->
| + | |
| − | | + | |
| − | | + | |
| − | <!-- Java Script======================================================================= -->
| + | |
| − | <script>window.jQuery || document.write('<script src="https://2016.igem.org/Template:Peking/Javascript/jquery_1_10_2_min?action=raw&ctype=text/javascript"><\/script>')</script>
| + | |
| − | <script type="text/javascript" src="https://2016.igem.org/Template:Peking/Javascript/jquery_migrate_1_2_1_min?action=raw&ctype=text/javascript"></script>
| + | |
| − | | + | |
| − | <script src="https://2016.igem.org/Template:Peking/Javascript/jquery_flexslider?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script src="https://2016.igem.org/Template:Peking/Javascript/doubleaptogo?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script src="https://2016.igem.org/Template:Peking/Javascript/init?action=raw&ctype=text/javascript"></script>
| + | |
| − | | + | |
| − | <!--quotations from flexslider: start-->
| + | |
| − | <script src='https://2016.igem.org/Template:Peking/Javascript/modernizr_js?action=raw&ctype=text/javascript'></script>
| + | |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_polaroid?action=raw&ctype=text/javascript'></script>
| + | |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_easing?action=raw&ctype=text/javascript'></script>
| + | |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_transform_0_8_0_min?action=raw&ctype=text/javascript'></script>
| + | |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_preloader?action=raw&ctype=text/javascript'></script>
| + | |
| − | <!--quotations from flexslider: end-->
| + | |
| − | | + | |
| − | <!--quotations from black: start-->
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_sticky?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_easing_1_3_pack?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/bootstrap_min?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_patallax_1_1_3?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/appear?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/modernizr?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_prettyPhoto?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/isotope?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_bxslider_min?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_cycle_all?action=raw&ctype=text/javascript" ></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_maximage?action=raw&ctype=text/javascript"></script>
| + | |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/scripts?action=raw&ctype=text/javascript "></script>
| + | |
| − | <!--quotations from black: end-->
| + | |
| − | | + | |
| − | | + | |
| − | </body>
| + | |
