Difference between revisions of "Team:NEFU China/Software2"

 
(3 intermediate revisions by the same user not shown)
Line 2: Line 2:
 
<head>
 
<head>
 
<meta charset="utf-8">
 
<meta charset="utf-8">
−
<title>Software 3</title>
+
<title>Software 2</title>
 
<meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1">
 
<meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1">
 
<link href="https://2018.igem.org/wiki/index.php?title=Template:NEFU_China/CSS-menu&action=raw&ctype=text/css"  rel="stylesheet" type="text/css">
 
<link href="https://2018.igem.org/wiki/index.php?title=Template:NEFU_China/CSS-menu&action=raw&ctype=text/css"  rel="stylesheet" type="text/css">
Line 205: Line 205:
 
var context =canvas.getContext("2d");
 
var context =canvas.getContext("2d");
 
var W = window.innerWidth;
 
var W = window.innerWidth;
−
                         var H = 15000;
+
                         var H = 4900;
 
//var H = window.innerHeight*1.5;
 
//var H = window.innerHeight*1.5;
 
canvas.width = W;
 
canvas.width = W;
Line 271: Line 271:
 
     <div class="row banner">
 
     <div class="row banner">
 
         <div class="banner-text">
 
         <div class="banner-text">
−
             <h1 class="responsive-headline" style="color: cyan!important;font-size: 80px;">English Word Segment</h1>
+
             <h1 class="responsive-headline" style="color:orange!important;font-size: 80px;">Enhance password security</h1>
−
             <h3 style="font-size: 25px!important;">Segment English Sentences without Spaces.<br>
+
             <h3 style="font-size: 25px!important;">Add random sequences, introns, and enzymes to the codon sequences.<br>
 
             </h3>
 
             </h3>
 
             <hr/>
 
             <hr/>
Line 280: Line 280:
  
 
<section id="resume" style="box-shadow: inset 0px 15px 15px -15px green">
 
<section id="resume" style="box-shadow: inset 0px 15px 15px -15px green">
−
<div class="row introduction" >
+
<div class="row introduction">
 
<div class="three columns header-col">
 
<div class="three columns header-col">
−
             <h1><span>intorduction</span></h1>
+
             <h1><span style="color: orange; font-size: 24px;">intorduction</span></h1>
 
         </div>
 
         </div>
 
         <div class="nine columns main-col">
 
         <div class="nine columns main-col">
Line 288: Line 288:
 
<div class="twelve columns">
 
<div class="twelve columns">
 
<h3>Aim</h3>
 
<h3>Aim</h3>
−
<p class="info">Segment English Sentences without Spaces.</p>
+
<p class="info" style="font-size: 26px!important;">Enhance password security</p>
−
<p>
+
<p style="font-size: 26px!important;">
−
In the Coding book, the space character has no corresponding codon. Therefore, we need to segment English sentences without Spaces. For example, the input sentence is "Iwanttostudybiologyeveryday", the output of the results should be: "i want to study biology everyday". In our program, firstly we implement word graph scanning based on prefix tree structure and construct DAG(Directed Acyclic Graph) to obtain all English word segmentation results, secondly we use IF-IDF(Term Frequency-Inverse Document Frequency) model and maximum sharding method to obtain the optimal word segmentation results.  
+
We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded.
 
</p>
 
</p>
 
</div>
 
</div>
Line 299: Line 299:
 
      <br>
 
      <br>
 
  <p>
 
  <p>
−
      <strong>1.Preprocessing entered data.</strong><br>
+
          <strong style="font-size: 26px!important;">1.Add random sequences, introns, and enzyme.</strong>
−
  <p>
+
      <p style="font-size: 26px!important;">
−
  Algorithm: Determine whether there are numbers in the entered data and whether there are empty data.<br>  
+
                              They are:<br>
−
  The English sentences that we entered have no Spaces. And they satisfy the following conditions:<br>
+
                              intron 1:<br>                                                                        
−
                      a.The English sentences do not contain any characters except letters, such as numbers, punctuation marks, etc.
+
                                ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA<br>
−
                      In the construction of our Coding Book, we establish the correspondence between letters and codons. Therefore, the digital and punctuation information will be lost during the period of decryption. Our software does not support these characters.<br>
+
                                   
−
                      b. The length of English sentences is no longer than 50.
+
    intron 2:<br>
−
                      As the length of English sentences grows longer, other introns appear in the codons, and this information will be cut in the organism. The probability of appearing introns increases with length. Therefore, we limit the length of the sentence to 50 characters.
+
                                ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA<br>
−
  <br><br>
+
                                         
−
  </p>
+
    enzyme 1：GAATTC<br>
−
      <p>
+
                                enzyme 2：GCTAGC <br>
−
  <strong>2.Find all possible word combinations.</strong><br>
+
                            </p>
−
  Algorithm: Achieve efficient word graph scanning based on a prefix tree structure. Build a DAG(Directed Acyclic Graph) to obtain all English word segmentation results.<br>  
+
                            <p style="font-size: 26px!important;"><br>
−
  In this process, we constructed a prefix tree tree and a directed acyclic graph.<br>
+
                            <strong>2.Check the security of the password.</strong>
−
                      A prefix tree, is a kind of search tree. We use the prefix tree for word frequency statistics. In this prefix tree, the root is associated with the empty string, and all the descendants of a node have a common prefix. In the search, we start from the root node and connect each character passing through the road as the corresponding string of the node. Using the prefix tree structure allows us to improve the speed of query words and the efficiency of search.<br>
+
                            <br>
−
                      The figure is a prefix tree structure of ever, very, every, go and good.<br>
+
                            </p>
−
      <br>
+
                            <br>
−
      </p>
+
                            <p style="font-size: 26px!important;">
−
      <div align="center">
+
                            We use regular expressions to detect if there are other intron sequences, enzyme sequences, to prevent our information from being cut off in the organism.<br>
−
  <img src="https://static.igem.org/mediawiki/2018/e/e2/T--NEFU_China--tree.png">
+
                            We mainly detect the following structures in the codon sequences:<br>
−
      </div>
+
                            A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
−
      <p>
+
                            A-B-C-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)CAG(.*)<br>
−
                      After constructing the prefix tree, we build a directed acyclic graph. In our DAG, each node is a letter, and each letter points to its next letter. If we detect a word, we add a directed edge between the first letter and the last letter of the word. Therefore, we can traverse all the segmentation results according to the DAG we constructed.<br>
+
                            A-B-C-B-A-B-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)UACUAAC(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
−
                      For example, if the sentence is "Iwanttostudybiologyeveryday", assumes that the word in the prefix tree as follows:<br>
+
                            A-A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
−
                      “and, biology, cat, day, ever, every, everyday, fat, guess, he, I, jeep, kangaroo, learn, mom, noon, opt, peach, quit, rust, study, to, you, very, want, xylan, yellow, zoom”<br>
+
                            </p>
−
                      Then the DAG is as shown in the figure.<br>
+
  </p>
−
  </p>
+
−
      <br>
+
−
  <div align="center">
+
−
  <img src="https://static.igem.org/mediawiki/2018/d/d0/T--NEFU_China--dfs.png">
+
−
      </div>
+
−
  <br>
+
−
      <br>
+
−
  <strong>3.Find the most probable combination</strong><br>
+
−
  Algorithm: Use IF-IDF(Term Frequency-Inverse Document Frequency) model and maximum sharding method to obtain the optimal word segmentation results.<br>  
+
−
  TF-IDF is a statistical method that can be used to assess how important a word is to  this document. The importance of a word increases proportionately as it appears in a document, but decreases inversely as it appears in the corpus. Its formula is as follows:<br>
+
−
      <br>
+
−
      <div align="center">
+
−
        <img src="https://static.igem.org/mediawiki/2018/b/be/T--NEFU_China--software3-01.png">
+
−
    </div>
+
−
      <br>
+
−
   
+
−
                      We can obtain the possibility of each word segmentation method by calculating TF-IDF, so as to find the most probable combination. In order to improve the efficiency of calculation, we use the idea of dynamic programming to carry out calculation.<br>
+
−
                      For example, for the word “everyday”, we have the possible word combinations: “ever, every, very, day, everyday”.<br>
+
−
      <br>
+
−
      <div align="center">
+
−
        <img src="https://static.igem.org/mediawiki/2018/9/90/T--NEFU_China--software3-02.png">
+
−
    </div>
+
−
      <br>
+
−
                      We need to calculate:<br>
+
−
                      (“xxx” means the TF-IDF value of the word xxx)<br>
+
−
route[9]=0;                                        e-v-e-r-y-d-a-y<br>
+
−
...<br>
+
−
route[6]=max(“day”+route[9], “d”+route[7])=“day”+route[9]  e-v-e-r-y-day<br>
+
−
...<br>
+
−
route[2]=max(“very+route[6], “v”+route[3])=“very+route[6]  e-very-day<br>
+
−
route[1]=max(“ever”+route[5], “every”+route[6], “everyday”+route[9])<br>  
+
−
= “everyday”+route[9]                          everyday<br>
+
−
So, the most probable combination is “everyday”.
+
−
  <br><br>
+
−
    </p>
+
 
                 </div>
 
                 </div>
 
             </div>  
 
             </div>  
Line 366: Line 331:
 
       </div>
 
       </div>
 
  <hr>
 
  <hr>
−
 
 
       <div class="row results">
 
       <div class="row results">
 
         <div class="three columns header-col">
 
         <div class="three columns header-col">
−
             <h1><span>RESULTS</span></h1>
+
             <h1><span style="color: orange;text-align: center;font-size: 25px;">Translate</span></h1>
 
         </div>
 
         </div>
 
         <div class="nine columns main-col">
 
         <div class="nine columns main-col">
 
             <div class="row item">
 
             <div class="row item">
 
               <div class="twelve columns">
 
               <div class="twelve columns">
−
               <h3>Warnings.</h3>
+
               <h3></h3>
−
                   <p>
+
                   <p style="font-size: 26px!important;">
 
Input:<br>
 
Input:<br>
−
please input the sentences:<br>
+
please enter the letters:ILOVEIGEM<br>
 
Output:<br>
 
Output:<br>
−
Warning: The entered data is empty.<br>  
+
condons:<br>  
−
Input:<br>
+
GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC<br>
−
please input the sentences:Iwanttostudy888biologyeveryday.<br>
+
−
Output:<br>
+
−
Warning: Please enter letters, you may enter some numbers.<br>
+
−
<br>
+
−
                  </p>
+
−
 
+
−
              </div>
+
−
            </div>
+
−
<div class="row item">
+
−
              <div class="twelve columns">
+
−
              <h3>Print DAG and all results.</h3>
+
−
                  <p>
+
−
Input:<br>
+
−
please input the sentences:Iwanttostudybiologyeveryday.<br>
+
−
Output:<br>
+
−
DAG：<br>
+
−
  {0: [0], 1: [4], 2: [2], 3: [3], 4: [4], 5: [6], 6: [6], 7: [11], 8: [8], 9: [9], 10: [10], 11: [11], 12: [18], 13: [13], 14: [14], 15: [17], 16: [16], 17: [17], 18: [18], 19: [22, 23, 26], 20: [23], 21: [21], 22: [22], 23: [23], 24: [26], 25: [25], 26: [26], 27: [27]}<br>
+
−
                    All results: i want to study biology log y ever every everyday very day .<br>  
+
 
 
−
<br>
+
There are no other introns.<br>
−
 
+
please enter the codon:<br>
−
      <div align="center">
+
GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC<br>
−
        <img src="https://static.igem.org/mediawiki/2018/f/fe/T--NEFU_China--software3-04.png" style="
+
['GUC', 'UUU', 'UCU', 'UCA', 'AAC', 'GUC', 'AUU', 'AAC', 'CGC']<br>
−
    width: 660px;
+
ILOVEIGEM<br><br>
−
">
+
−
    </div>
+
−
      <br>
+
−
                  </p>
+
−
 
+
−
              </div>
+
−
</div>
+
−
<div class="row item"> 
+
−
              <div class="twelve columns">
+
−
              <h3>Print best result</h3>
+
−
                  <p>
+
−
Route:<br>
+
−
  {<br>
+
−
28: (0, 0), <br>
+
−
27: (0, 27), <br>
+
−
26: (0, 26), <br>
+
−
25: (9.857849805800359e-08, 25), <br>
+
−
24: (2.3106801949289814e-06, 26),<br>  
+
−
23: (2.3106801949289814e-06, 23), <br>
+
−
22: (2.3106801949289814e-06, 22), <br>
+
−
21: (2.3106801949289814e-06, 21), <br>
+
−
20: (4.671241819750759e-06, 23), <br>
+
−
19: (0.00011031439602868175, 26), <br>
+
−
18: (0.00011031439602868175, 18), <br>
+
−
17: (0.00011031439602868175, 17), <br>
+
−
16: (0.00011031439602868175, 16), <br>
+
−
15: (0.00022651239742305776, 17), <br>
+
−
14: (0.00022651239742305776, 14), <br>
+
−
13: (0.00022651239742305776, 13), <br>
+
−
12: (0.0002681925141215141, 18), <br>
+
−
11: (0.0002681925141215141, 11), <br>
+
−
10: (0.0002681925141215141, 10),<br>
+
−
9: (0.0002681925141215141, 9),<br>
+
−
8: (0.0002681925141215141, 8), <br>
+
−
7: (0.0002727594331865744, 11), <br>
+
−
6: (0.0002727594331865744, 6), <br>
+
−
5: (0.00027285757717578014, 6), <br>
+
−
4: (0.00027285757717578014, 4), <br>
+
−
3: (0.00027285757717578014, 3), <br>
+
−
2: (0.00027295615567383817, 2), <br>
+
−
1: (0.0002747994303250776, 4), <br>
+
−
0: (0.0002747994303250776, 0)}<br>
+
−
Best result: I want to study biology everyday .<br>
+
−
+
−
<br>
+
−
 
+
−
  <div align="center">
+
−
        <img src="https://static.igem.org/mediawiki/2018/b/bc/T--NEFU_China--software3-03.png" style="
+
−
    width: 660px;
+
−
">
+
−
  </div>
+
 
                   </p>
 
                   </p>
−
 
 
 
               </div>
 
               </div>
 
             </div>  
 
             </div>  
Line 463: Line 357:
 
         </div>  
 
         </div>  
 
       </div>  
 
       </div>  
−
  <hr>
+
<hr>
 
  <div class="row others">
 
  <div class="row others">
 
         <div class="three columns header-col">
 
         <div class="three columns header-col">
−
             <h1><span>Others</span></h1>
+
             <h1 style="font-size: 33px;color: orange;"><span>Others</span></h1>
 
         </div>
 
         </div>
 
         <div class="nine columns main-col">
 
         <div class="nine columns main-col">
−
              
+
             <div class="row item">
 +
              <div class="twelve columns">
 +
              <h3>QRcode</h3>
 +
               
 +
                  <p style="font-size: 26px!important;">
 +
                  We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.<br>
 +
                  You can scan it to see what you'll find!<br>
 +
      <br>
 +
      <div align="center">
 +
  <img src="https://static.igem.org/mediawiki/2018/1/1e/T--NEFU_China--codons.png" style="width: 330px;">
 +
  <img src="https://static.igem.org/mediawiki/2018/c/cf/T--NEFU_China--letters.png" style="width: 330px;">
 +
  </div>
 +
  <br>
 +
                  </p>
 +
              </div>
 +
            </div>
 
<div class="row item">
 
<div class="row item">
 
               <div class="twelve columns">
 
               <div class="twelve columns">
 
               <h3>Visual Software</h3>
 
               <h3>Visual Software</h3>
 
                  
 
                  
−
                   <p>
+
                   <p style="font-size: 26px!important;">
−
                   We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.<br>
+
                   We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.
 +
                  <br><br>
 
      Software interface:<br>
 
      Software interface:<br>
 
      <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/5/5c/T--NEFU_China--software-v1.png">
 
      <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/5/5c/T--NEFU_China--software-v1.png">
 +
 +
                  <br><br>
 
      Letters to Codons:<br>
 
      Letters to Codons:<br>
−
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/3/35/T--NEFU_China--software-v2.png">
+
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/3/35/T--NEFU_China--software-v2.png"><br>
 +
                  <br>
 
  Codons to letters:<br>
 
  Codons to letters:<br>
 
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/8/8d/T--NEFU_China--software-v3.png">
 
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/8/8d/T--NEFU_China--software-v3.png">
Line 490: Line 403:
 
        
 
        
 
                   <p>
 
                   <p>
−
                   <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/3.Englishwordsegment">1.Englishwordsegment</a><br>
+
                   <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/1.Coding">1.Coding</a><br>
−
       
+
      <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/1.Coding">2.QRcode</a><br>
−
      <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/6.Visualization">2.Visualization</a><br>
+
  <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/1.Coding">3.QRcode+Segment</a><br>
−
    <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/8.MainWindow.exe">3.Visualizaiton.exe</a><br>
+
      <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/6.Visualization">4.Visualization</a><br>
−
                  
+
    <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/8.MainWindow.exe">5.Visualizaiton.exe</a><br>
 +
                 </p>
 +
              </div>
 +
 
 +
            </div>
 +
        </div>
 +
      </div>
 +
</section>
 +
 
 
</body>
 
</body>
  
 
</html>
 
</html>

Latest revision as of 12:49, 9 November 2018

Software 2

intorduction

Aim

Enhance password security

We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded.

Programming


1.Add random sequences, introns, and enzyme.

They are:
intron 1:
ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA
intron 2:
ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA
enzyme 1：GAATTC
enzyme 2：GCTAGC


2.Check the security of the password.


We use regular expressions to detect if there are other intron sequences, enzyme sequences, to prevent our information from being cut off in the organism.
We mainly detect the following structures in the codon sequences:
A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)
A-B-C-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)CAG(.*)
A-B-C-B-A-B-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)UACUAAC(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)
A-A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)

Translate

Input:
please enter the letters:ILOVEIGEM
Output:
condons:
GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC
There are no other introns.
please enter the codon:
GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC
['GUC', 'UUU', 'UCU', 'UCA', 'AAC', 'GUC', 'AUU', 'AAC', 'CGC']
ILOVEIGEM

Others

QRcode

We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.
You can scan it to see what you'll find!


Visual Software

We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.

Software interface:


Letters to Codons:


Codons to letters:

Download

1.Coding
2.QRcode
3.QRcode+Segment
4.Visualization
5.Visualizaiton.exe