Difference between revisions of "Team:NEFU China/Software2"

 
(2 intermediate revisions by the same user not shown)
Line 282: Line 282:
 
<div class="row introduction">
 
<div class="row introduction">
 
<div class="three columns header-col">
 
<div class="three columns header-col">
             <h1><span style="
+
             <h1><span style="color: orange; font-size: 24px;">intorduction</span></h1>
    color: orange;
+
    font-size: 24px;
+
">intorduction</span></h1>
+
 
         </div>
 
         </div>
 
         <div class="nine columns main-col">
 
         <div class="nine columns main-col">
Line 291: Line 288:
 
<div class="twelve columns">
 
<div class="twelve columns">
 
<h3>Aim</h3>
 
<h3>Aim</h3>
<p class="info" style="
+
<p class="info" style="font-size: 26px!important;">Enhance password security</p>
    font-size: 26px!important;
+
<p style="font-size: 26px!important;">
">Enhance password security</p>
+
<p>
+
 
We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded.
 
We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded.
 
</p>
 
</p>
Line 304: Line 299:
 
      <br>
 
      <br>
 
  <p>
 
  <p>
      <strong style="
+
          <strong style="font-size: 26px!important;">1.Add random sequences, introns, and enzyme.</strong>
    font-size: 26px!important;
+
      <p style="font-size: 26px!important;">
">1.Add random sequences, introns, and enzyme.</strong>
+
                              They are:<br>
  <p style="
+
                              intron 1:<br>                                                                        
    font-size: 26px!important;
+
                                ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA<br>
">
+
                                   
They are:<br>
+
    intron 2:<br>
intron 1:<br>
+
                                ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA<br>
ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA<br>
+
                                         
intron 2:<br>
+
    enzyme 1:GAATTC<br>
ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA<br>
+
                                enzyme 2:GCTAGC <br>
enzyme 1:GAATTC<br>
+
                            </p>
enzyme 2:GCTAGC <br>
+
                            <p style="font-size: 26px!important;"><br>
</p>
+
                            <strong>2.Check the security of the password.</strong>
 
+
                            <br>
 
+
                            </p>
 
+
                            <br>
<p style="
+
                            <p style="font-size: 26px!important;">
    font-size: 26px!important;
+
                            We use regular expressions to detect if there are other intron sequences, enzyme sequences, to prevent our information from being cut off in the organism.<br>
">
+
                            We mainly detect the following structures in the codon sequences:<br>
<strong>2.Check the security of the password.</strong>
+
                            A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
<br>
+
                            A-B-C-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)CAG(.*)<br>
</p><br>
+
                            A-B-C-B-A-B-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)UACUAAC(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
<p>
+
                            A-A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
</p><p style="
+
                            </p>
    font-size: 26px!important;
+
">
+
We use regular expressions to detect if there are other intron sequences, enzyme sequences, to prevent our information from being cut off in the organism.<br>
+
We mainly detect the following structures in the codon sequences:<br>
+
A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
+
A-B-C-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)CAG(.*)<br>
+
A-B-C-B-A-B-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)UACUAAC(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
+
A-A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
+
</p>
+
<p></p>
+
 
  </p>
 
  </p>
 
                 </div>
 
                 </div>
Line 348: Line 333:
 
       <div class="row results">
 
       <div class="row results">
 
         <div class="three columns header-col">
 
         <div class="three columns header-col">
             <h1><span style="
+
             <h1><span style="color: orange;text-align: center;font-size: 25px;">Translate</span></h1>
    color: orange;
+
    text-align: center;
+
    font-size: 25px;
+
">Translate</span></h1>
+
 
         </div>
 
         </div>
 
         <div class="nine columns main-col">
 
         <div class="nine columns main-col">
Line 358: Line 339:
 
               <div class="twelve columns">
 
               <div class="twelve columns">
 
               <h3></h3>
 
               <h3></h3>
                   <p style="
+
                   <p style="font-size: 26px!important;">
    font-size: 26px!important;
+
">
+
 
Input:<br>
 
Input:<br>
 
please enter the letters:ILOVEIGEM<br>
 
please enter the letters:ILOVEIGEM<br>
Line 381: Line 360:
 
  <div class="row others">
 
  <div class="row others">
 
         <div class="three columns header-col">
 
         <div class="three columns header-col">
             <h1 style="
+
             <h1 style="font-size: 33px;color: orange;"><span>Others</span></h1>
    font-size: 33px;
+
    color: orange;
+
"><span>Others</span></h1>
+
 
         </div>
 
         </div>
 
         <div class="nine columns main-col">
 
         <div class="nine columns main-col">
Line 391: Line 367:
 
               <h3>QRcode</h3>
 
               <h3>QRcode</h3>
 
                  
 
                  
                   <p style="
+
                   <p style="font-size: 26px!important;">
    font-size: 26px!important;
+
">
+
 
                   We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.<br>
 
                   We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.<br>
 
                   You can scan it to see what you'll find!<br>
 
                   You can scan it to see what you'll find!<br>
  <br>
+
      <br>
 
      <div align="center">
 
      <div align="center">
 
  <img src="https://static.igem.org/mediawiki/2018/1/1e/T--NEFU_China--codons.png" style="width: 330px;">
 
  <img src="https://static.igem.org/mediawiki/2018/1/1e/T--NEFU_China--codons.png" style="width: 330px;">
Line 409: Line 383:
 
               <h3>Visual Software</h3>
 
               <h3>Visual Software</h3>
 
                  
 
                  
                   <p style="
+
                   <p style="font-size: 26px!important;">
    font-size: 26px!important;
+
">
+
 
                   We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.
 
                   We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.
<br><br>
+
                  <br><br>
 
      Software interface:<br>
 
      Software interface:<br>
 
      <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/5/5c/T--NEFU_China--software-v1.png">
 
      <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/5/5c/T--NEFU_China--software-v1.png">
  
<br><br>
+
                  <br><br>
 
      Letters to Codons:<br>
 
      Letters to Codons:<br>
 
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/3/35/T--NEFU_China--software-v2.png"><br>
 
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/3/35/T--NEFU_China--software-v2.png"><br>
<br>
+
                  <br>
 
  Codons to letters:<br>
 
  Codons to letters:<br>
 
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/8/8d/T--NEFU_China--software-v3.png">
 
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/8/8d/T--NEFU_China--software-v3.png">

Latest revision as of 12:49, 9 November 2018

Software 2

intorduction

Aim

Enhance password security

We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded.

Programming


1.Add random sequences, introns, and enzyme.

They are:
intron 1:
ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA
intron 2:
ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA
enzyme 1:GAATTC
enzyme 2:GCTAGC


2.Check the security of the password.


We use regular expressions to detect if there are other intron sequences, enzyme sequences, to prevent our information from being cut off in the organism.
We mainly detect the following structures in the codon sequences:
A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)
A-B-C-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)CAG(.*)
A-B-C-B-A-B-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)UACUAAC(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)
A-A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)


Translate

Input:
please enter the letters:ILOVEIGEM
Output:
condons:
GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC
There are no other introns.
please enter the codon:
GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC
['GUC', 'UUU', 'UCU', 'UCA', 'AAC', 'GUC', 'AUU', 'AAC', 'CGC']
ILOVEIGEM


Others

QRcode

We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.
You can scan it to see what you'll find!


Visual Software

We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.

Software interface:


Letters to Codons:


Codons to letters: