Difference between revisions of "Team:NEFU China/Software2"

Line 3: Line 3:
 
<meta charset="utf-8">
 
<meta charset="utf-8">
 
<title>Software 2</title>
 
<title>Software 2</title>
−
<meta http-equiv="X-UA-Compatible" content="IE=edge">
+
<meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1">
 
<link href="https://2018.igem.org/wiki/index.php?title=Template:NEFU_China/CSS-menu&action=raw&ctype=text/css"  rel="stylesheet" type="text/css">
 
<link href="https://2018.igem.org/wiki/index.php?title=Template:NEFU_China/CSS-menu&action=raw&ctype=text/css"  rel="stylesheet" type="text/css">
 
<link href="https://2018.igem.org/wiki/index.php?title=Template:NEFU_China/CSS-members-foot&action=raw&ctype=text/css"  rel="stylesheet" type="text/css">
 
<link href="https://2018.igem.org/wiki/index.php?title=Template:NEFU_China/CSS-members-foot&action=raw&ctype=text/css"  rel="stylesheet" type="text/css">
Line 20: Line 20:
 
     margin-left: 0px;
 
     margin-left: 0px;
 
}
 
}
−
.foot {
+
#menu li ul li:hover ul{
−
     font-size: 20px;
+
    background:rgba(0,0,0,0.75)!important;
 +
}
 +
li#mainlevel_01 a {
 +
     color: #FFE5B5!important;
 +
 +
}
 +
li#mainlevel_01 a:hover {
 +
    font-size:30px!important;
 +
    text-shadow:0px 0px 8px #FFE5B5,
 +
                0px 0px 42px #FFE5B5,
 +
                0px 0px 72px #FFE5B5,
 +
                0px 0px 150px #FFE5B5;
 +
}
 +
li#mainlevel_02 a {
 +
    color: #FFE5B5!important;
 +
}
 +
li#mainlevel_02 a:hover {
 +
    font-size:30px!important;
 +
    text-shadow:0px 0px 8px #FFE5B5,
 +
                0px 0px 42px #FFE5B5,
 +
                0px 0px 72px #FFE5B5,
 +
                0px 0px 150px #FFE5B5;
 +
}
 +
li#mainlevel_03 a {
 +
    color: #FFE5B5!important;
 +
}
 +
li#mainlevel_03 a:hover {
 +
    font-size:30px!important;
 +
    text-shadow:0px 0px 8px #FFE5B5,
 +
                0px 0px 42px #FFE5B5,
 +
                0px 0px 72px #FFE5B5,
 +
                0px 0px 150px #FFE5B5;
 +
}
 +
li#mainlevel_05 a {
 +
    color: #FFE5B5!important;
 +
}
 +
li#mainlevel_05 a:hover {
 +
    font-size:30px!important;
 +
    text-shadow:0px 0px 8px #FFE5B5,
 +
                0px 0px 42px #FFE5B5,
 +
                0px 0px 72px #FFE5B5,
 +
                0px 0px 150px #FFE5B5;
 +
}
 +
li#mainlevel_06 a {
 +
    color: #FFE5B5!important;
 +
}
 +
li#mainlevel_06 a:hover {
 +
    font-size:30px!important;
 +
    text-shadow:0px 0px 8px #FFE5B5,
 +
                0px 0px 42px #FFE5B5,
 +
                0px 0px 72px #FFE5B5,
 +
                0px 0px 150px #FFE5B5;
 +
}
 +
li#mainlevel_07 a {
 +
    color: #FFE5B5!important;
 +
}
 +
li#mainlevel_07 a:hover {
 +
    font-size:30px!important;
 +
    text-shadow:0px 0px 8px #FFE5B5,
 +
                0px 0px 42px #FFE5B5,
 +
                0px 0px 72px #FFE5B5,
 +
                0px 0px 150px #FFE5B5;
 +
}
 +
li#mainlevel_08 a {
 +
    color: #FFE5B5!important;
 +
}
 +
li#mainlevel_08 a:hover {
 +
    font-size:30px!important;
 +
    text-shadow:0px 0px 8px #FFE5B5,
 +
                0px 0px 42px #FFE5B5,
 +
                0px 0px 72px #FFE5B5,
 +
                0px 0px 150px #FFE5B5;
 +
}
 +
#menu li ul li ul li a:hover {
 +
    color: rgba(0,223,252,1);
 +
    border-top: dotted 1px rgba(255,255,255,0.91);
 +
    border-bottom: dotted 1px rgba(255,255,255,0.91);
 +
    background: rgba(0,223,252,.02);
 +
}
 +
#nav .mainlevel a {
 +
    color: black;
 +
    text-decoration:none;
 +
    line-height:32px;
 +
    display:block;
 +
    padding:0 5px;
 +
    font-size: 25px!important;
 +
font-family: 'Segoe UI', Roboto, 'Helvetica Neue', Arial, sans-serif, 'Apple Color Emoji', 'Segoe UI Emoji', 'Segoe UI Symbol', 'Noto Color Emoji' !important;
 +
}
 +
.layer-bottom {
 +
z-index: -2;
 +
position: absolute;
 +
margin-top: 0px!important;
 +
}
 +
#foot-title h3{
 +
font-size: 18px!important;
 
}
 
}
 
</style>
 
</style>
Line 28: Line 122:
 
<body>
 
<body>
 
<!--menu-->
 
<!--menu-->
−
<div id="menu">
+
 
−
<li id="nav">&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;
+
<div id="menu" style="background-color:rgba(0,0,0,0.6)!important">
−
+
<li id="nav" style="left: 8%!important; width: 100%!important;">&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;
 +
<!--<a class="menu1" href="#" style="text-align: right;">☰</a>-->
 
<ul class="firstmenu" style="float: left">
 
<ul class="firstmenu" style="float: left">
 
 
Line 46: Line 141:
 
  </ul>
 
  </ul>
 
  </li>
 
  </li>
−
  <li class="mainlevel" id="mainlevel_03">
+
−
  <a href="https://2018.igem.org/Team:NEFU_China/Basic_Part"><img id="parts" src="https://static.igem.org/mediawiki/2018/5/58/T--NEFU_China--_PARTS.png">PARTS</a>
+
 +
<li class="mainlevel" id="mainlevel_03">
 +
  <a href="https://2018.igem.org/Team:NEFU_China/Experiment"><img id="parts" src="https://static.igem.org/mediawiki/2018/6/62/T--NEFU_China--_RESULTS.png">EXPERIMENT</a>
 
  <ul id="sub_03">
 
  <ul id="sub_03">
 +
  <li><a href="https://2018.igem.org/Team:NEFU_China/Lock_Key" target="_self">LOCK &amp; KEY</a></li>
 +
  <li><a href="https://2018.igem.org/Team:NEFU_China/Suicide" target="_self">SUICIDE</a></li>
 +
  <li><a href="https://2018.igem.org/Team:NEFU_China/Splicing" target="_self">SPLICING</a></li>
 +
  <li><a href="https://2018.igem.org/Team:NEFU_China/Demonstrate" target="_self">DEMONSTRATE</a></li>
 +
  <hr>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Basic_Part" target="_self">BASIC PARTS</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Basic_Part" target="_self">BASIC PARTS</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Composite_Part" target="_self">COMPOSITE PARTS</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Composite_Part" target="_self">COMPOSITE PARTS</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Improve" target="_self">IMPROVEMENT PARTS</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Improve" target="_self">IMPROVEMENT PARTS</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Part_Collection" target="_self">PARTS COLLECTION</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Part_Collection" target="_self">PARTS COLLECTION</a></li>
 +
  <hr>
 +
  <li><a href="https://2018.igem.org/Team:NEFU_China/Notebook" target="_self">NOTEBOOK</a></li>
 +
  <li><a href="https://2018.igem.org/Team:NEFU_China/Protocol" target="_self">PROTOCOL</a></li>
 
  </ul>
 
  </ul>
 
  </li>
 
  </li>
−
      <li class="mainlevel" id="mainlevel_04">
+
   
−
  <a href="https://2018.igem.org/Team:NEFU_China/Lock_Key"><img id="results" src="https://static.igem.org/mediawiki/2018/6/62/T--NEFU_China--_RESULTS.png">RESULTS</a>
+
−
  <ul id="sub_04">
+
−
  <li><a href="https://2018.igem.org/Team:NEFU_China/Lock_Key" target="_self">LOCK &amp; KEY</a></li>
+
−
  <li><a href="https://2018.igem.org/Team:NEFU_China/Suicide" target="_self">SUICIDE</a></li>
+
−
  <li><a href="https://2018.igem.org/Team:NEFU_China/Splicing" target="_self">SPLICING</a></li>
+
−
  </ul>
+
−
  </li>
+
 
  <li class="mainlevel" id="mainlevel_05">
 
  <li class="mainlevel" id="mainlevel_05">
 
  <a href="https://2018.igem.org/Team:NEFU_China/Model"><img id="model" src="https://static.igem.org/mediawiki/2018/0/0c/T--NEFU_China--_MODEL.png">MODEL</a>
 
  <a href="https://2018.igem.org/Team:NEFU_China/Model"><img id="model" src="https://static.igem.org/mediawiki/2018/0/0c/T--NEFU_China--_MODEL.png">MODEL</a>
Line 75: Line 173:
 
  <ul id="sub_06">
 
  <ul id="sub_06">
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Software" target="_self">OVERVIEW</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Software" target="_self">OVERVIEW</a></li>
−
  <li><a href="https://2018.igem.org/Team:NEFU_China/Software1" target="_self">SOFTWARE1</a></li>
+
  <li><a href="https://2018.igem.org/Team:NEFU_China/Software1" target="_self">CODING</a></li>
−
  <li><a href="https://2018.igem.org/Team:NEFU_China/Software2" target="_self">SOFTWARE2</a></li>
+
  <li><a href="https://2018.igem.org/Team:NEFU_China/Software2" target="_self">MISLEADING</a></li>
 +
  <li><a href="https://2018.igem.org/Team:NEFU_China/Software3" target="_self">WORDSEGMENT</a></li>
 
  </ul>
 
  </ul>
 
  </li>
 
  </li>
Line 84: Line 183:
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Attributions" target="_self">ATTRIBUTIONS</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Attributions" target="_self">ATTRIBUTIONS</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Members" target="_self">MEMBERS</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Members" target="_self">MEMBERS</a></li>
 +
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Sponsoring" target="_self">SPONSORING</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Sponsoring" target="_self">SPONSORING</a></li>
 
  </ul>
 
  </ul>
Line 94: Line 194:
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Collaborations" target="_self">COLLABORTION</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Collaborations" target="_self">COLLABORTION</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Public_Engagement" target="_self">EDUCATION &amp; PUBLIC ENGAGEMENT</a></li>
 
  <li><a href="https://2018.igem.org/Team:NEFU_China/Public_Engagement" target="_self">EDUCATION &amp; PUBLIC ENGAGEMENT</a></li>
−
  </ul>
 
−
  </li>
 
−
  <li class="mainlevel" id="mainlevel_09">
 
−
  <a href="https://2018.igem.org/Team:NEFU_China/Notebook"><img id="notebook" src="https://static.igem.org/mediawiki/2018/c/cb/T--NEFU_China--_NOTEBOOK.png">NOTEBOOK</a>
 
−
  <ul id="sub_09">
 
−
  <li><a href="https://2018.igem.org/Team:NEFU_China/Notebook" target="_self">OVERVIRW</a></li>
 
−
  <li><a href="https://2018.igem.org/Team:NEFU_China/Protocol" target="_self">PROTOCOL</a></li>
 
 
  </ul>
 
  </ul>
 
  </li>
 
  </li>
Line 107: Line 200:
 
</li>
 
</li>
 
</div>
 
</div>
−
<header id="home2">
+
<div class="layer-bottom">
 +
 +
<canvas id="canvas" style="background:#000000"></canvas>
 +
 
 +
<script type="text/javascript">
 +
 +
window.onload = function(){
 +
var canvas = document.getElementById("canvas");
 +
var context =canvas.getContext("2d");
 +
var W = window.innerWidth;
 +
                        var H = 6000;
 +
//var H = window.innerHeight*1.5;
 +
canvas.width = W;
 +
canvas.height = H;
 +
var fontSize = 20;
 +
var colunms = Math.floor(W /fontSize);
 +
var drops = [];
 +
for(var i=0;i<colunms;i++){
 +
drops.push(0);
 +
}
 +
 
 +
 
 +
var str1 = "ATCG";
 +
                        var str2 = "01";
 +
function draw(){
 +
context.fillStyle = "rgba(0,0,0,0.2)";
 +
context.fillRect(0,0,W,H);
 +
context.font = "700 "+fontSize+"px  微软雅黑";
 +
context.fillStyle = "#003544";
 +
for(var i=0;i<colunms/2;i++){
 +
var index = Math.floor(Math.random() * str1.length);
 +
var x = i*fontSize;
 +
var y = drops[i] *fontSize;
 +
context.fillText(str1[index],x,y);
 +
if(y >= canvas.height){
 +
drops[i] = 0;
 +
}
 +
                                        if(Math.random() > 0.99){
 +
                                                drops[i] = 0;
 +
}
 +
drops[i]++;
 +
}
 +
                                for(var i=colunms/2;i<colunms;i++){
 +
var index = Math.floor(Math.random() * str2.length);
 +
var x = i*fontSize;
 +
var y = drops[i] *fontSize;
 +
context.fillText(str2[index],x,y);
 +
if(y >= canvas.height){
 +
drops[i] = 0;
 +
}
 +
                                        if(Math.random() > 0.99){
 +
                                                drops[i] = 0;
 +
}
 +
drops[i]++;
 +
}
 +
};
 +
 
 +
function randColor(){
 +
var r = Math.floor(Math.random() * 256);
 +
var g = Math.floor(Math.random() * 256);
 +
var b = Math.floor(Math.random() * 256);
 +
return "rgb("+r+","+g+","+b+")";
 +
}
 +
 
 +
draw();
 +
setInterval(draw,60);
 +
};
 +
 
 +
</script>
 +
 +
           
 +
 +
</div>
 +
<header id="home-banner">
 
     <div class="row banner">
 
     <div class="row banner">
 
         <div class="banner-text">
 
         <div class="banner-text">
−
             <h1 class="responsive-headline">Software 2's Name</h1>
+
             <h1 class="responsive-headline" style="color: cyan!important;">Enhance password security</h1>
−
             <h3>Software's introduction.<br>
+
             <h3 style="font-size: 25px!important;">Add random sequences, introns, and enzymes to the codon sequences.<br>
 
             </h3>
 
             </h3>
 
             <hr/>
 
             <hr/>
Line 117: Line 283:
 
     </div>
 
     </div>
 
</header>  
 
</header>  
−
<section id="resume" style="box-shadow: inset 0px 15px 15px -15px orange">
+
 
 +
<section id="resume" style="box-shadow: inset 0px 15px 15px -15px green">
 
<div class="row introduction" >
 
<div class="row introduction" >
 
<div class="three columns header-col">
 
<div class="three columns header-col">
Line 125: Line 292:
 
             <div class="row item">
 
             <div class="row item">
 
<div class="twelve columns">
 
<div class="twelve columns">
−
<h3>Software 2's title 1</h3>
+
<h3>Aim</h3>
−
<p class="info">Features:ssssssssssssssssssssssss</p>
+
<p class="info">Enhance password security</p>
 
<p>
 
<p>
−
It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way.
+
We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded.
 
</p>
 
</p>
 
</div>
 
</div>
Line 134: Line 301:
 
             <div class="row item">
 
             <div class="row item">
 
               <div class="twelve columns">
 
               <div class="twelve columns">
−
  <h3>Software 2's title 2</h3>
+
  <h3>Programming</h3>
−
  <p class="info">Features:ssssssssssssssssssssssss</p>
+
      <br>
 
  <p>
 
  <p>
−
  It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way.
+
      <strong>1.Add random sequences, introns, and enzyme.</strong><br>
−
  </p>
+
  They are:<br>
−
                </div>
+
                      intron 1:<br> ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA<br>
−
            </div>  
+
                      intron 2:<br> ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA<br>
−
    <div class="row item">
+
                      enzyme 1：GAATTC<br>
−
              <div class="twelve columns">
+
                      enzyme 2：GCTAGC
−
  <h3>Software 2's title 3</h3>
+
  <br><br>
−
  <p class="info">Features:ssssssssssssssssssssssss</p>
+
  <strong>2.Check the security of the password.</strong><br>
−
  <p>
+
  We use regular expressions to detect if there are other intron sequences, enzyme sequences, to prevent our information from being cut off in the organism.<br>
−
  It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way.
+
                      We mainly detect the following structures in the codon sequences:<br>
−
  </p>
+
                      A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
 +
  A-B-C-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)CAG(.*)<br>
 +
  A-B-C-B-A-B-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)UACUAAC(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
 +
  A-A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br>
 +
      <br>
 
                 </div>
 
                 </div>
 
             </div>  
 
             </div>  
 +
 
         </div>  
 
         </div>  
 
       </div>
 
       </div>
Line 155: Line 327:
 
       <div class="row results">
 
       <div class="row results">
 
         <div class="three columns header-col">
 
         <div class="three columns header-col">
−
             <h1><span>RESULTS</span></h1>
+
             <h1><span>Translate</span></h1>
 
         </div>
 
         </div>
 
         <div class="nine columns main-col">
 
         <div class="nine columns main-col">
 
             <div class="row item">
 
             <div class="row item">
 
               <div class="twelve columns">
 
               <div class="twelve columns">
−
               <h3>Result 1</h3>
+
               <h3></h3>
−
                  <p class="info">Features：sssssssssssssss</p>
+
−
 
+
 
                   <p>
 
                   <p>
−
                  It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way.
+
Input:<br>
 +
please enter the letters:ILOVEIGEM<br>
 +
Output:<br>
 +
condons:<br> GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC<br>
 +
intron 1:<br> ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA<br>
 +
intron 2:<br> ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA<br>
 +
There are no other introns.<br>
 +
please enter the codon:GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC<br>
 +
['GUC', 'UUU', 'UCU', 'UCA', 'AAC', 'GUC', 'AUU', 'AAC', 'CGC']<br>
 +
ILOVEIGEM<br><br>
 
                   </p>
 
                   </p>
 
               </div>
 
               </div>
−
             </div>  
+
             </div>
−
            <div class="row item">
+
−
              <div class="twelve columns">
+
−
                  <h3>Result 2</h3>
+
−
                  <p class="info">Features：sssssssssssssss</p>
+
−
                  <p>
+
−
                  It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way.
+
−
                </p>
+
−
              </div>
+
−
 
+
−
            </div>
+
−
<div class="row item">
+
−
              <div class="twelve columns">
+
−
                  <h3>Result 3</h3>
+
−
                  <p class="info">Features：sssssssssssssss</p>
+
−
                  <p>
+
−
                  It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way.
+
−
                </p>
+
−
 
+
−
              </div>
+
−
            </div>
+
 
         </div>  
 
         </div>  
 
       </div>  
 
       </div>  
Line 198: Line 358:
 
             <div class="row item">
 
             <div class="row item">
 
               <div class="twelve columns">
 
               <div class="twelve columns">
−
               <h3>Parameters</h3>
+
               <h3>QRcode</h3>
−
                   <p class="info">Features：sssssssssssssss</p>
+
               
−
 
+
                   <p>
 +
                  We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.<br>
 +
                  You can scan it to see what you'll find!<br>
 +
     
 +
                  </p>
 +
              </div>
 +
            </div>
 +
<div class="row item">
 +
              <div class="twelve columns">
 +
              <h3>Visual Software</h3>
 +
               
 
                   <p>
 
                   <p>
−
                   It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way.
+
                   We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.<br>
 +
      Software interface:<br>
 +
      <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/5/5c/T--NEFU_China--software-v1.png">
 +
      Letters to Codons:<br>
 +
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/3/35/T--NEFU_China--software-v2.png">
 +
  Codons to letters:<br>
 +
  <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/8/8d/T--NEFU_China--software-v3.png">
 
                   </p>
 
                   </p>
 
               </div>
 
               </div>
Line 209: Line 385:
 
               <div class="twelve columns">
 
               <div class="twelve columns">
 
                   <h3>Download</h3>
 
                   <h3>Download</h3>
−
                  <p class="info">Features：sssssssssssssss</p>
+
     
 
                   <p>
 
                   <p>
−
                   It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way.
+
                   <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/1.Coding">1.Coding</a><br>
 +
      <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/1.Coding">2.QRcode</a><br>
 +
  <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/1.Coding">3.QRcode+Segment</a><br>
 +
      <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/6.Visualization">4.Visualization</a><br>
 +
    <a href="https://github.com/igemsoftware2018/Team_NEFU_China/tree/master/8.MainWindow.exe">5.Visualizaiton.exe</a><br>
 
                 </p>
 
                 </p>
 
               </div>
 
               </div>

Revision as of 17:16, 15 October 2018

Software 2

intorduction

Aim

Enhance password security

We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded.

Programming


1.Add random sequences, introns, and enzyme.
They are:
intron 1:
ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA
intron 2:
ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA
enzyme 1：GAATTC
enzyme 2：GCTAGC

2.Check the security of the password.
We use regular expressions to detect if there are other intron sequences, enzyme sequences, to prevent our information from being cut off in the organism.
We mainly detect the following structures in the codon sequences:
A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)
A-B-C-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)CAG(.*)
A-B-C-B-A-B-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)UACUAAC(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)
A-A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)

Translate

Input:
please enter the letters:ILOVEIGEM
Output:
condons:
GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC
intron 1:
ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA
intron 2:
ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA
There are no other introns.
please enter the codon:GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC
['GUC', 'UUU', 'UCU', 'UCA', 'AAC', 'GUC', 'AUU', 'AAC', 'CGC']
ILOVEIGEM

Others

QRcode

We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.
You can scan it to see what you'll find!

Visual Software

We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.
Software interface:
Letters to Codons:
Codons to letters:

Download

1.Coding
2.QRcode
3.QRcode+Segment
4.Visualization
5.Visualizaiton.exe

Userfull links

Home     Model    Project    Software   

Parts      Teams   Results   Notebook   

Human  Practice

Follow us

facebook     twitter     wehchat
facebook     twitter     wehchat

Contact us

iGEM-NEFU_China2018

Email: hexinglu@nefu.edu.cn

No.26 Hexing Road, Xiangfang
District, Harbin, Heilongjiang
Province 150000