Blablablabla (Talk | contribs) |
|||
Line 271: | Line 271: | ||
<div class="row banner"> | <div class="row banner"> | ||
<div class="banner-text"> | <div class="banner-text"> | ||
− | <h1 class="responsive-headline" style="color: | + | <h1 class="responsive-headline" style="color:orange!important;font-size: 80px;">Enhance password security</h1> |
<h3 style="font-size: 25px!important;">Add random sequences, introns, and enzymes to the codon sequences.<br> | <h3 style="font-size: 25px!important;">Add random sequences, introns, and enzymes to the codon sequences.<br> | ||
</h3> | </h3> | ||
Line 280: | Line 280: | ||
<section id="resume" style="box-shadow: inset 0px 15px 15px -15px green"> | <section id="resume" style="box-shadow: inset 0px 15px 15px -15px green"> | ||
− | <div class="row introduction" > | + | <div class="row introduction"> |
<div class="three columns header-col"> | <div class="three columns header-col"> | ||
− | <h1><span>intorduction</span></h1> | + | <h1><span style=" |
+ | color: orange; | ||
+ | font-size: 24px; | ||
+ | ">intorduction</span></h1> | ||
</div> | </div> | ||
<div class="nine columns main-col"> | <div class="nine columns main-col"> | ||
Line 288: | Line 291: | ||
<div class="twelve columns"> | <div class="twelve columns"> | ||
<h3>Aim</h3> | <h3>Aim</h3> | ||
− | <p class="info">Enhance password security</p> | + | <p class="info" style=" |
+ | font-size: 26px!important; | ||
+ | ">Enhance password security</p> | ||
<p> | <p> | ||
We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded. | We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded. | ||
Line 299: | Line 304: | ||
<br> | <br> | ||
<p> | <p> | ||
− | <strong>1.Add random sequences, introns, and enzyme.</strong>< | + | <strong style=" |
− | + | font-size: 26px!important; | |
− | + | ">1.Add random sequences, introns, and enzyme.</strong> | |
− | + | <p style=" | |
− | + | font-size: 26px!important; | |
− | + | "> | |
− | + | They are:<br> | |
− | + | intron 1:<br> | |
− | + | ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA<br> | |
− | + | intron 2:<br> | |
− | + | ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA<br> | |
− | + | enzyme 1:GAATTC<br> | |
− | + | enzyme 2:GCTAGC <br> | |
− | + | </p> | |
− | + | ||
− | + | ||
+ | |||
+ | <p style=" | ||
+ | font-size: 26px!important; | ||
+ | "> | ||
+ | <strong>2.Check the security of the password.</strong> | ||
+ | <br> | ||
+ | </p><br> | ||
+ | <p> | ||
+ | </p><p style=" | ||
+ | font-size: 26px!important; | ||
+ | "> | ||
+ | We use regular expressions to detect if there are other intron sequences, enzyme sequences, to prevent our information from being cut off in the organism.<br> | ||
+ | We mainly detect the following structures in the codon sequences:<br> | ||
+ | A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br> | ||
+ | A-B-C-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)CAG(.*)<br> | ||
+ | A-B-C-B-A-B-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)UACUAAC(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br> | ||
+ | A-A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)<br> | ||
+ | </p> | ||
+ | <p></p> | ||
+ | </p> | ||
</div> | </div> | ||
</div> | </div> | ||
Line 323: | Line 348: | ||
<div class="row results"> | <div class="row results"> | ||
<div class="three columns header-col"> | <div class="three columns header-col"> | ||
− | <h1><span>Translate</span></h1> | + | <h1><span style=" |
+ | color: orange; | ||
+ | text-align: center; | ||
+ | font-size: 25px; | ||
+ | ">Translate</span></h1> | ||
</div> | </div> | ||
<div class="nine columns main-col"> | <div class="nine columns main-col"> | ||
Line 329: | Line 358: | ||
<div class="twelve columns"> | <div class="twelve columns"> | ||
<h3></h3> | <h3></h3> | ||
− | <p> | + | <p style=" |
+ | font-size: 26px!important; | ||
+ | "> | ||
Input:<br> | Input:<br> | ||
please enter the letters:ILOVEIGEM<br> | please enter the letters:ILOVEIGEM<br> | ||
Line 350: | Line 381: | ||
<div class="row others"> | <div class="row others"> | ||
<div class="three columns header-col"> | <div class="three columns header-col"> | ||
− | <h1><span>Others</span></h1> | + | <h1 style=" |
+ | font-size: 33px; | ||
+ | color: orange; | ||
+ | "><span>Others</span></h1> | ||
</div> | </div> | ||
<div class="nine columns main-col"> | <div class="nine columns main-col"> | ||
Line 357: | Line 391: | ||
<h3>QRcode</h3> | <h3>QRcode</h3> | ||
− | <p> | + | <p style=" |
+ | font-size: 26px!important; | ||
+ | "> | ||
We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.<br> | We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.<br> | ||
You can scan it to see what you'll find!<br> | You can scan it to see what you'll find!<br> | ||
Line 368: | Line 404: | ||
<h3>Visual Software</h3> | <h3>Visual Software</h3> | ||
− | <p> | + | <p style=" |
− | We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.<br> | + | font-size: 26px!important; |
+ | "> | ||
+ | We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions. | ||
+ | <br><br> | ||
Software interface:<br> | Software interface:<br> | ||
<img style="width:750px;" src="https://static.igem.org/mediawiki/2018/5/5c/T--NEFU_China--software-v1.png"> | <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/5/5c/T--NEFU_China--software-v1.png"> | ||
+ | |||
+ | <br><br> | ||
Letters to Codons:<br> | Letters to Codons:<br> | ||
− | <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/3/35/T--NEFU_China--software-v2.png"> | + | <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/3/35/T--NEFU_China--software-v2.png"><br> |
+ | <br> | ||
Codons to letters:<br> | Codons to letters:<br> | ||
<img style="width:750px;" src="https://static.igem.org/mediawiki/2018/8/8d/T--NEFU_China--software-v3.png"> | <img style="width:750px;" src="https://static.igem.org/mediawiki/2018/8/8d/T--NEFU_China--software-v3.png"> |
Revision as of 02:50, 18 October 2018
intorduction
Aim
Enhance password security
We added random sequences, introns, and enzymes to the codon sequences so that the intercepted codon information would not be easily decoded.
Programming
1.Add random sequences, introns, and enzyme.
They are:
intron 1:
ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTA
intron 2:
ATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAA
enzyme 1:GAATTC
enzyme 2:GCTAGC
2.Check the security of the password.
We use regular expressions to detect if there are other intron sequences, enzyme sequences, to prevent our information from being cut off in the organism.
We mainly detect the following structures in the codon sequences:
A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)
A-B-C-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)CAG(.*)
A-B-C-B-A-B-C:(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)UACUAAC(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)
A-A-A-B-C:(.*)GUAUGU(.*)GUAUGU(.*)GUAUGU(.*)UACUAAC(.*)CAG(.*)
Translate
Input:
please enter the letters:ILOVEIGEM
Output:
condons:
GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC
There are no other introns.
please enter the codon:
GAATTCTAGGTTGCTTCTTTTAGTGGTTTGCAAUGGUCUUUUCUUCAAACGUCAUUAACGUAUGUATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCTTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAUACUAACCAGGUAUGUATGGGTAGAGTTAGAACCAAGACCGTCAAGCGTGCTTCTAAGGCTTTGATTGAACGTTACTATCCAAAGTTGACTTTGGATTTCCAAACCAACAAGAGACTTTGTGATGAAATCGCCACTATCCAATCCAAGAGATTGAGAAACAAGATTGCTGGTTACACCACCCATTTGATGAAGAGAATCCAAAAGGGTCCAGTTAGAGGTATCTCTTTCAAATTGCAAGAAGAAGAAAGAGAAAGAAAGGACCAATACGTCCCAGAAGTCTCTGCTTTGGACTTGTCTCGTTCTAACGGTGTTTTGAACGTTGACAACCAAACTTCTGACTTGGTTAAATCTTTGGGTTTGAAGTTGCCATTATCTGTTATCAACGTTTCTGCCCAAAGAGACAGACGTTACAGAAAGAGAGTTTAAUACUAACCAGCGCUAATTTTCGTCTCTTATTATTAAACCTTTAAAAACGCTATCCTTGACTTTATCTGTACTTTGCAATAAAAGCAGGCTCTGAGTGTTTAAATCTATTTTTCTTTCATTCGCTAGC
['GUC', 'UUU', 'UCU', 'UCA', 'AAC', 'GUC', 'AUU', 'AAC', 'CGC']
ILOVEIGEM
Others
QRcode
We write the information of codons and letters into the picture as a qr code and users can scan the qr code to get this information.
You can scan it to see what you'll find!
Visual Software
We developed a visual software. There are an input textbox, an output textbox, two radio buttons and a translate button in the software interface. We can choose radio buttons to select letters to codons or codons to letters. In addition to these, our software can also provide open files, copy files, cut files, save files, print files and other basic functions.
Software interface:
Letters to Codons:
Codons to letters: