Team:Madrid-OLM/Computationaimprovement
Computational improvement of the aptamer
The target of this protocol is to improve the union affinity between the protein and the aptamer, obtained by the process that had been explained previously, by bioinformatics methods.
To carry out this affinity improvement, you can start from only 2 elements: the DNA aptamer sequence and the name or preferably the amino acid protein sequence. However, any extra information that you could find in previous studies could be so helpful to save time and reduce the margin of cumulative error. The complete protocol have four different sections:
-
• Obtaining the 3D protein structure.
-
• Obtaining the 3D aptamer structure (most critical point).
-
• Search of the binding site between protein and aptamer through a docking process.
-
• Study of the union and proposal of mutation in the sequence.
It is very important to understand that this process not guarantee a better result. However it gives the opportunity of improve the aptamer obtained. Although there are so much works with proteins structures and the interaction between each other’s, there are almost no studies that work with nucleic acids in simulation or structure prediction terms beyond double strand helix. Therefore any final result obtained should be checked in the laboratory, either to confirm or discard the new sequence obtained.
Obtaining the 3D protein structure
The final result of this sección should be a file in .pdb format where we can find the coordinates of every single atom of the protein. That file could be interpreted by bioinformatics programs like Phymol or Chimera and represent the protein in different graphical ways. To obtain it, there are two different paths depending on one fact: has the protein been previously crystallographed?
A structure obtained experimentally exists
We will simply use this proven structure. This will be the most reliable method due to it has been the result of a group's investigation. To check if there is any previous structure we recommend the following simple steps:
-
1. Access the UniProt server and search for the protein of interest.
-
2. Search for the structure description area and check if it has an entry to the Protein Data Bank (PDB) database.
-
3. In the positive case, access that PDB entry and download the file that is needed.
-
4. In case of no entry, the steps explained in the next section must be performed.
Clarification, the PDB is a universal database where are the 3D structure of all proteins which have been obtained its structure experimentally. That is, any structure that we find there is quite reliable and proven. However, predictions of structures are not included, owing to this procedure is not experimental.
A structure obtained experimentally don’t exists.
In this case is necessary to do a structure prediction process. Although this is not the optimal way due to we will start to accumulate error, we can obtain very reliable results. Several different methods can be used for this purpose. We recommend the following two and in this order:
-
1. Homology methods: This method looks for sequences of proteins that are included in the PDB that have a high similarity with our protein and adopt its 3D structure. If the result shows a similarity of more than 30% in the entire sequence, we could take for granted the structure. Otherwise, if it gives inferior, we should move on to the next step. For this step we recommend the Swiss-Model server.
-
2. I-Tasser (Iterative Threading ASSEmbly Refinement): This server uses several methods, as they define themselves: “a hierarchical approach to protein structure and function prediction. It first identifies structural templates from the PDB by multiple threading approach LOMETS, with full-length atomic models constructed by iterative template fragment assembly simulations.” This method is currently the most reliable and they have been the winners in predicting structure in the last 6 editions of the CAP tests.
-
3. As an extra option we can mention Robetta: It is an ab-initio simulation method, where it try to create the protein from 0, using physical simulation and gross computational power. It works best for short sequences and can take a long time to get results, but these are very reliable.
Energy minimization.
This last step is completely recommendable whatever it be the origin of the file with the structure. It will be necessary to have the structure in a state as stable as possible. To minimize the structure we can use 2 strategies:
-
1. Quick vacuum minimization This is the simplest method. For this purpose we will use the Chimera program and within its tools we will choose the "Energy minimization". Then we will adjust the parameters to what is most convenient for us.
-
2. Minimization in aqueous medium: Complex method, for which we recommend looking for a tutorial to understand the management of the programs used and the necessary concepts. In this more complex case, we will use the VMD program (Visual Molecular Dynamics). It will be necessary to build a structure around the protein with the "Automatic PSF builder" tool, which includes water molecules and ions. Subsequently a simulation of energy minimization will be carried out with the tool "AutoIMD" which in turn calls an external program (NAND) that must be installed on the PC. Finally, the resulting file should be saved and opened in Chimera to eliminate all water molecules and leave only the structure of the protein.
Figure 1. Comparison of the structure of Ole E1 before (purple) and after (blue) an energy minimization process.
Figure 2. Ole E1 after an energy minimization process represented as ribbon and as ASA (Accessible Surface Area). Made by Chimera tool..
Obtaining the 3D aptamer structure
Previously there were two options, that the protein had a knowing structure or not. In this case it is a DNA chain that we have personally obtained in the laboratory, so the possibility of find a structure published for that exact sequence it's almost zero. In this way the only case to consider is to try to predict its structure. This action presents a series of drawbacks nowadays. While for proteins there are numerous methods and servers with high reliability, for nucleic acids there are hardly any servers and prediction methods. This is due to the structure of proteins has always been very important and varied for its function, but from the genetic material, the important thing has always been its code, whether in the form of DNA or RNA. For the case of RNAs, there is more than one function, reason why in certain occasions if it has been attended to the need to know their structures but it has not been developed correctly. Even so, we propose a series of steps to predict the structure of the aptamer. Although this predicted structure will not be reliable and it is important to understand this, it can serve us for our objective of proposing an improvement in the initial sequence.
Step1: Obtaining the secondary structure
As there is no single server as in proteins to obtain a final result giving only the sequence, we have to separate the process in different stages. In this first stage we need to obtain a secondary structure of the single strand of DNA. The server we recommend is the MFold server of the University of Albany. It provides both a graphic map of the links between bases, and the secondary structure in text format (in the Vienna format that we need later), as we show in this example:
GTGACGTAGGTTGGTGTGGTTGGGGCGTCAC
(((((((.................)))))))
Figure 3. Example image of the links between base pairs that the server provides.
Obtaining the 3D protein structure
Cosas del apartado 1, se necesita meter mas divs seguramente
Obtaining the 3D protein structure
Cosas del apartado 1, se necesita meter mas divs seguramente