Difference between revisions of "Team:Tianjin/Improve"

 
(22 intermediate revisions by 7 users not shown)
Line 8: Line 8:
 
         <meta content="width=device-width,initial-scale=1.0,maximum-scale=1.0,user-scalable=0;" name="viewport">
 
         <meta content="width=device-width,initial-scale=1.0,maximum-scale=1.0,user-scalable=0;" name="viewport">
 
         <meta name="renderer" content="webkit">
 
         <meta name="renderer" content="webkit">
−
         <meta name="author" content="773715181 HanJiaxiao">
+
         <meta name="author" content="773715181 Jiaxiao Han">
 
         <meta content="2018iGEM Team:Tianjin Kai System to control biological clock" name="description">
 
         <meta content="2018iGEM Team:Tianjin Kai System to control biological clock" name="description">
 
         <meta content="Team:Tianjin,iGEM:Tianjin,iGEM,2018iGEM" name="keywords">
 
         <meta content="Team:Tianjin,iGEM:Tianjin,iGEM,2018iGEM" name="keywords">
Line 15: Line 15:
 
         <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/bootstrap?action=raw&ctype=text/css">
 
         <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/bootstrap?action=raw&ctype=text/css">
 
         <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/base?action=raw&ctype=text/css">
 
         <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/base?action=raw&ctype=text/css">
−
         <link href="//netdna.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet">
+
         <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/font-awesome?action=raw&ctype=text/css">
 
         <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/text?action=raw&ctype=text/css">
 
         <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/text?action=raw&ctype=text/css">
 
         <script src="https://2018.igem.org/Team:Tianjin/js/bootstrap?action=raw&ctype=text/javascript"></script>
 
         <script src="https://2018.igem.org/Team:Tianjin/js/bootstrap?action=raw&ctype=text/javascript"></script>
 +
        <style>a:visited{    color: #337ab7;}</style>
 
</head>
 
</head>
 
<!-- delete.css  -->
 
<!-- delete.css  -->
Line 28: Line 29:
 
.igem_2018_team_menu{display:none !important;}
 
.igem_2018_team_menu{display:none !important;}
 
</style>
 
</style>
−
<script src="https://use.fontawesome.com/597ba5ca72.js"></script>
+
 
 
<script>
 
<script>
 
$('#top_title').remove();$("#globalWrapper").removeAttr("id");$("#content").removeAttr("id");$("#HQ_page").removeAttr("id");$('.mw-body').removeClass('mw-body');$('.igem_2018_team_mobile_bar').remove();
 
$('#top_title').remove();$("#globalWrapper").removeAttr("id");$("#content").removeAttr("id");$("#HQ_page").removeAttr("id");$('.mw-body').removeClass('mw-body');$('.igem_2018_team_mobile_bar').remove();
Line 62: Line 63:
 
                 </a>
 
                 </a>
 
                 <ul class="dropdown-menu" style="left: -14px;">
 
                 <ul class="dropdown-menu" style="left: -14px;">
−
                     <li><a href="https://2018.igem.org/Team:Tianjin/Description">DESCRIPTION</a></li>
+
                     <li><a href="https://2018.igem.org/Team:Tianjin/Description">BACKGROUND</a></li>
 
                     <li><a href="https://2018.igem.org/Team:Tianjin/Design">DESIGN</a></li>
 
                     <li><a href="https://2018.igem.org/Team:Tianjin/Design">DESIGN</a></li>
 
                     <li><a href="https://2018.igem.org/Team:Tianjin/Experiments">EXPERIMENTS</a></li>
 
                     <li><a href="https://2018.igem.org/Team:Tianjin/Experiments">EXPERIMENTS</a></li>
Line 95: Line 96:
 
                 </a>
 
                 </a>
 
                 <ul class="dropdown-menu">
 
                 <ul class="dropdown-menu">
−
                     <li><a href="https://2018.igem.org/Team:Tianjin/Human_Practices">INTEGRATED HP</a></li>
+
                     <li><a href="https://2018.igem.org/Team:Tianjin/Human_Practices">INTEGRATED</a></li>
 
                     <li><a href="https://2018.igem.org/Team:Tianjin/Collaborations">COLLABORATION</a></li>
 
                     <li><a href="https://2018.igem.org/Team:Tianjin/Collaborations">COLLABORATION</a></li>
−
                     <li><a href="https://2018.igem.org/Team:Tianjin/Public_Engagement">EDU&PUBLIC ENGAGEMENT</a></li>
+
                     <li><a href="https://2018.igem.org/Team:Tianjin/Public_Engagement">PUBLIC ENGAGEMENT</a></li>
 
                 </ul>
 
                 </ul>
 
             </li>
 
             </li>
Line 111: Line 112:
 
             </li>
 
             </li>
 
             <li>
 
             <li>
−
                 <a href="https://igem.org/2018_Judging_Form?team=Tianjin">
+
                 <a href="https://2018.igem.org/Team:Tianjin/Judging">
−
                    JUDGING FORM                
+
                  FOR JUDGES                
 
                 </a>
 
                 </a>
 
             </li>
 
             </li>
Line 126: Line 127:
 
         <div id="bannercontent">
 
         <div id="bannercontent">
 
             <div id="BgChange">
 
             <div id="BgChange">
−
                 <img src="https://static.igem.org/mediawiki/2018/3/32/T--Tianjin--partB5.jpg" style="width: 100%;">
+
                 <img src="https://static.igem.org/mediawiki/2018/1/14/T--Tianjin--improved.png" style="width: 100%;">
 
             </div>
 
             </div>
 
         </div>
 
         </div>
 
     </div>
 
     </div>
−
     <div class="container">
+
     <div class="container ">
 
         <div class="row">
 
         <div class="row">
−
             <div class="col-xs-12 titleBox">
+
          <div class="row partition"></div>
−
                 <div class="title title-big">
+
        <div class="row">
−
                     <p>PARTS OVERVIEW</p>
+
            <div class="col-xs-12 text">
 +
                <p>
 +
                    We improved a new part (<a href="http://parts.igem.org/Part:BBa_K2637010">BBa_K2637010</a>) from the wide-used luciferase, NanoLuc (<a href="http://parts.igem.org/Part:BBa_K1680009">BBa_K1680009</a>) to speed up its degradation and increase the sensitivity.
 +
                </p>
 +
            </div>
 +
             <div class="col-xs-12 ">
 +
                 <div class="title title-normal">
 +
                     <p>Description</p>
 
                 </div>
 
                 </div>
 +
            </div>
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    Inspired by our time-course measurement for the KaiABC oscillatory system, we realized the importance of the sensitivity of reporter genes when used to characterize the variation in our engineering strains.<br>
 +
                    With the knowledge that the instability of proteins is associated with the existence of the so-called PEST regions, which control the ubiquitination of regulatory short-lived proteins<sup><a href="#re1">[1]</a></sup>, we decided to optimize our NanoLuc with the potentially degrading sequence PSET to shorten its intracellular lifetime.
 +
                </p>
 
             </div>
 
             </div>
 
         </div>
 
         </div>
−
         <div class="row partition">
+
         <div class="row">
−
              
+
             <div class="col-xs-12 ">
 +
                <div class="title title-normal">
 +
                    <p>Function of PEST</p>
 +
                </div>
 +
            </div>
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    The covalent linkage of ubiquitin to lysine residues of substrate proteins is a common means used by eucaryotic cells to signal their degradation by the 26S proteasome, a multiprotease complex located in the cytoplasm and the nucleus<sup><a href="#re2">[2]</a></sup>. Decades ago it had been demonstrated that the PEST regions, enriched with Pro, Glu, Ser, and Thr, were identified to indeed control the ubiquitination of regulatory short-lived proteins<sup><a href="#re1">[1]</a></sup>
 +
, such as transactivator Gcn4<sup><a href="#re3">[3]</a></sup> and G1 cyclins in yeast and mammalian cells. Phosphorylation of particular Ser or Thr residues in the PEST regions of these G1 cyclins specifies their recognition and processing by the ubiquitin-proteasome pathway.
 +
                </p>
 +
            </div>
 
         </div>
 
         </div>
 
         <div class="row">
 
         <div class="row">
 
             <div class="col-xs-12 ">
 
             <div class="col-xs-12 ">
 
                 <div class="title title-normal">
 
                 <div class="title title-normal">
−
                 
+
                    <p>Sequence and features</p>
 
                 </div>
 
                 </div>
 
             </div>
 
             </div>
 
             <div class="col-xs-12 text">
 
             <div class="col-xs-12 text">
 
                 <p>
 
                 <p>
−
                     In this part page, we uploaded most of the Biobricks involved in our project and optimized them to meet the requirements. This also includes the improvements we made to the previous part. You can find all the Biobricks you want to know about our project here. Better yet, you can use some of our Biobricks to build your own oscillator.
+
                     Sequence: <br>
 +
                    AACTCTCACGGTTTCCCACCAGAAGTTGAAGAACAAGCTGCTGGTACTTTGCCAATGTCTTGTGCTCAAGAATCTGG<br>TATGGACAGACACCCAGCTGCTTGTGCTTCTGCTAGAATCAACGTT<br>
 +
                    Features: shortener NanoLuc lifetime contributes to the higher sensitivity
 
                 </p>
 
                 </p>
 +
            </div>
 +
        </div>
 +
        <div class="row">
 +
            <div class="col-xs-12 ">
 +
                <div class="title title-normal">
 +
                    <p>Origin（Organism）</p>
 +
                </div>
 
             </div>
 
             </div>
 
             <div class="col-xs-12 text">
 
             <div class="col-xs-12 text">
 
                 <p>
 
                 <p>
−
                     According to the requirements of the Bronze prize, we measured the experimental data of parts<a href="http://parts.igem.org/Part:BBa_E2030" target="_blank">BBa_E2030</a> and <a href="http://parts.igem.org/Part:BBa_E2060" target="_blank">BBa_E2060</a>, and you can see more details on part main pages.
+
                     Sequence: <br>
 +
                    PEST sequence can be found in variety of eukaryotic cells and the sequence we used was from the literature Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate<sup><a href="#re4">[4]</a></sup>.
 
                 </p>
 
                 </p>
 +
            </div>
 +
        </div>
 +
        <div class="row">
 +
            <div class="col-xs-12 ">
 +
                <div class="title title-normal">
 +
                    <p>Experimental characterization</p>
 +
                </div>
 +
            </div>
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    We compare the degradation of the origin with improved NanoLuc in 3 hours.
 +
                </p>
 +
            </div>
 +
 +
 +
<div align="center"><img src="https://static.igem.org/mediawiki/2018/e/e0/T--Tianjin--NanoLuchPEST.jpg" height="400"></div>
 +
 +
 +
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    You can download the protocol from the <a href="https://2018.igem.org/Team:Tianjin/Notebook">notebook</a>.<br>
 +
                    In this case, we have proved the newly constructed NanoLucPEST could work effectively in <em>Saccharomyces cerevisiae</em> BY4741. The sensitive reporter can be used in ample types of yeast after appropriate codon-optimization<sup><a href="#re5">[5]</a></sup>
 +
                </p>
 +
            </div>
 +
        </div>
 +
 +
       
 +
        <div class="row">
 +
            <div>
 +
                <div class="reference">
 +
                    <h1>References</h1>
 +
                    <p class="reftext" id="re1">
 +
                        <a>[1]Rogers, S., R. Wells, and M. Rechsteiner. 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 234:364–368.</a>
 +
                        <br>
 +
                    </p>
 +
                    <p class="reftext" id="re2">
 +
                        <a>[2]5. Ciechanover, A. 1994. The ubiquitin-proteasome proteolytic pathway. Cell 79:13–21.</a>
 +
                        <br>
 +
                    </p>
 +
                    <p class="reftext" id="re3">
 +
                        <a>[3] Kornitzer, D., B. Raboy, R. G. Kulka, and G. R. Fink. 1994. Regulated degradation of the transcription factor Gcn4. EMBO J. 13:6021–6030.</a>
 +
                        <br>
 +
                    </p>
 +
                    <p class="reftext" id="re4">
 +
                        <a>[4]Hall MP, Unch J, Binkowski BF, et al. 2012. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol 7: 1848–1857.</a>
 +
                        <br>
 +
                    </p>
 +
                    <p class="reftext" id="re5">
 +
                        <a>[5]Anna E. Masser, Ganapathi Kandasamy, Jayasankar Mohanakrishnan Kaimal and Claes Andréasson.Luciferase NanoLuc as a reporter for gene expression and protein levels in Saccharomyces cerevisiae.YEAST 2016. DOI: 10.1002/yea.3155</a>
 +
                        <br>
 +
                    </p>
 +
                </div>   
 
             </div>
 
             </div>
 
         </div>
 
         </div>
 
     </div>
 
     </div>
 +
</div>
  
 
     <div id="footer" style="background-color: #79acdd;text-align: center;">
 
     <div id="footer" style="background-color: #79acdd;text-align: center;">

Latest revision as of 13:03, 6 December 2018

<!DOCTYPE html> Team:Tianjin - 2018.igem.org

We improved a new part (BBa_K2637010) from the wide-used luciferase, NanoLuc (BBa_K1680009) to speed up its degradation and increase the sensitivity.

Description

Inspired by our time-course measurement for the KaiABC oscillatory system, we realized the importance of the sensitivity of reporter genes when used to characterize the variation in our engineering strains.
With the knowledge that the instability of proteins is associated with the existence of the so-called PEST regions, which control the ubiquitination of regulatory short-lived proteins[1], we decided to optimize our NanoLuc with the potentially degrading sequence PSET to shorten its intracellular lifetime.

Function of PEST

The covalent linkage of ubiquitin to lysine residues of substrate proteins is a common means used by eucaryotic cells to signal their degradation by the 26S proteasome, a multiprotease complex located in the cytoplasm and the nucleus[2]. Decades ago it had been demonstrated that the PEST regions, enriched with Pro, Glu, Ser, and Thr, were identified to indeed control the ubiquitination of regulatory short-lived proteins[1] , such as transactivator Gcn4[3] and G1 cyclins in yeast and mammalian cells. Phosphorylation of particular Ser or Thr residues in the PEST regions of these G1 cyclins specifies their recognition and processing by the ubiquitin-proteasome pathway.

Sequence and features

Sequence:
AACTCTCACGGTTTCCCACCAGAAGTTGAAGAACAAGCTGCTGGTACTTTGCCAATGTCTTGTGCTCAAGAATCTGG
TATGGACAGACACCCAGCTGCTTGTGCTTCTGCTAGAATCAACGTT
Features: shortener NanoLuc lifetime contributes to the higher sensitivity

Origin（Organism）

Sequence:
PEST sequence can be found in variety of eukaryotic cells and the sequence we used was from the literature Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate[4].

Experimental characterization

We compare the degradation of the origin with improved NanoLuc in 3 hours.

You can download the protocol from the notebook.
In this case, we have proved the newly constructed NanoLucPEST could work effectively in Saccharomyces cerevisiae BY4741. The sensitive reporter can be used in ample types of yeast after appropriate codon-optimization[5]

References

[1]Rogers, S., R. Wells, and M. Rechsteiner. 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 234:364–368.

[2]5. Ciechanover, A. 1994. The ubiquitin-proteasome proteolytic pathway. Cell 79:13–21.

[3] Kornitzer, D., B. Raboy, R. G. Kulka, and G. R. Fink. 1994. Regulated degradation of the transcription factor Gcn4. EMBO J. 13:6021–6030.

[4]Hall MP, Unch J, Binkowski BF, et al. 2012. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol 7: 1848–1857.

[5]Anna E. Masser, Ganapathi Kandasamy, Jayasankar Mohanakrishnan Kaimal and Claes Andréasson.Luciferase NanoLuc as a reporter for gene expression and protein levels in Saccharomyces cerevisiae.YEAST 2016. DOI: 10.1002/yea.3155