Difference between revisions of "Team:Tianjin/Improve"
| (19 intermediate revisions by 7 users not shown) | |||
| Line 8: | Line 8: | ||
<meta content="width=device-width,initial-scale=1.0,maximum-scale=1.0,user-scalable=0;" name="viewport"> | <meta content="width=device-width,initial-scale=1.0,maximum-scale=1.0,user-scalable=0;" name="viewport"> | ||
<meta name="renderer" content="webkit"> | <meta name="renderer" content="webkit"> | ||
| − | <meta name="author" content="773715181 | + | <meta name="author" content="773715181 Jiaxiao Han"> |
<meta content="2018iGEM Team:Tianjin Kai System to control biological clock" name="description"> | <meta content="2018iGEM Team:Tianjin Kai System to control biological clock" name="description"> | ||
<meta content="Team:Tianjin,iGEM:Tianjin,iGEM,2018iGEM" name="keywords"> | <meta content="Team:Tianjin,iGEM:Tianjin,iGEM,2018iGEM" name="keywords"> | ||
| Line 15: | Line 15: | ||
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/bootstrap?action=raw&ctype=text/css"> | <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/bootstrap?action=raw&ctype=text/css"> | ||
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/base?action=raw&ctype=text/css"> | <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/base?action=raw&ctype=text/css"> | ||
| − | <link href="// | + | <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/font-awesome?action=raw&ctype=text/css"> |
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/text?action=raw&ctype=text/css"> | <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/text?action=raw&ctype=text/css"> | ||
<script src="https://2018.igem.org/Team:Tianjin/js/bootstrap?action=raw&ctype=text/javascript"></script> | <script src="https://2018.igem.org/Team:Tianjin/js/bootstrap?action=raw&ctype=text/javascript"></script> | ||
| + | <style>a:visited{ color: #337ab7;}</style> | ||
</head> | </head> | ||
<!-- delete.css --> | <!-- delete.css --> | ||
| Line 28: | Line 29: | ||
.igem_2018_team_menu{display:none !important;} | .igem_2018_team_menu{display:none !important;} | ||
</style> | </style> | ||
| − | + | ||
<script> | <script> | ||
$('#top_title').remove();$("#globalWrapper").removeAttr("id");$("#content").removeAttr("id");$("#HQ_page").removeAttr("id");$('.mw-body').removeClass('mw-body');$('.igem_2018_team_mobile_bar').remove(); | $('#top_title').remove();$("#globalWrapper").removeAttr("id");$("#content").removeAttr("id");$("#HQ_page").removeAttr("id");$('.mw-body').removeClass('mw-body');$('.igem_2018_team_mobile_bar').remove(); | ||
| Line 62: | Line 63: | ||
</a> | </a> | ||
<ul class="dropdown-menu" style="left: -14px;"> | <ul class="dropdown-menu" style="left: -14px;"> | ||
| − | <li><a href="https://2018.igem.org/Team:Tianjin/Description"> | + | <li><a href="https://2018.igem.org/Team:Tianjin/Description">BACKGROUND</a></li> |
<li><a href="https://2018.igem.org/Team:Tianjin/Design">DESIGN</a></li> | <li><a href="https://2018.igem.org/Team:Tianjin/Design">DESIGN</a></li> | ||
<li><a href="https://2018.igem.org/Team:Tianjin/Experiments">EXPERIMENTS</a></li> | <li><a href="https://2018.igem.org/Team:Tianjin/Experiments">EXPERIMENTS</a></li> | ||
| Line 97: | Line 98: | ||
<li><a href="https://2018.igem.org/Team:Tianjin/Human_Practices">INTEGRATED</a></li> | <li><a href="https://2018.igem.org/Team:Tianjin/Human_Practices">INTEGRATED</a></li> | ||
<li><a href="https://2018.igem.org/Team:Tianjin/Collaborations">COLLABORATION</a></li> | <li><a href="https://2018.igem.org/Team:Tianjin/Collaborations">COLLABORATION</a></li> | ||
| − | <li><a href="https://2018.igem.org/Team:Tianjin/Public_Engagement"> | + | <li><a href="https://2018.igem.org/Team:Tianjin/Public_Engagement">PUBLIC ENGAGEMENT</a></li> |
</ul> | </ul> | ||
</li> | </li> | ||
| Line 111: | Line 112: | ||
</li> | </li> | ||
<li> | <li> | ||
| − | <a href="https://igem.org/ | + | <a href="https://2018.igem.org/Team:Tianjin/Judging"> |
| − | + | FOR JUDGES | |
</a> | </a> | ||
</li> | </li> | ||
| Line 126: | Line 127: | ||
<div id="bannercontent"> | <div id="bannercontent"> | ||
<div id="BgChange"> | <div id="BgChange"> | ||
| − | <img src="https://static.igem.org/mediawiki/2018/ | + | <img src="https://static.igem.org/mediawiki/2018/1/14/T--Tianjin--improved.png" style="width: 100%;"> |
</div> | </div> | ||
</div> | </div> | ||
| Line 132: | Line 133: | ||
<div class="container "> | <div class="container "> | ||
<div class="row"> | <div class="row"> | ||
| − | + | <div class="row partition"></div> | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
<div class="row"> | <div class="row"> | ||
<div class="col-xs-12 text"> | <div class="col-xs-12 text"> | ||
<p> | <p> | ||
| − | We improved a new part (<a href="">BBa_K2637010</a>) from the wide-used luciferase, NanoLuc (<a href="">BBa_K1680009</a>) to speed up its degradation and increase the sensitivity. | + | We improved a new part (<a href="http://parts.igem.org/Part:BBa_K2637010">BBa_K2637010</a>) from the wide-used luciferase, NanoLuc (<a href="http://parts.igem.org/Part:BBa_K1680009">BBa_K1680009</a>) to speed up its degradation and increase the sensitivity. |
</p> | </p> | ||
</div> | </div> | ||
| Line 165: | Line 160: | ||
<div class="col-xs-12 text"> | <div class="col-xs-12 text"> | ||
<p> | <p> | ||
| − | The covalent linkage of ubiquitin to lysine residues of substrate proteins is a common means used by eucaryotic cells to signal their degradation by the 26S proteasome, a multiprotease complex located in the cytoplasm and the nucleus<sup><a href="#re2">[2]</a></sup>. Decades ago it had been demonstrated that the PEST regions, enriched with Pro, Glu, Ser, and Thr, were identified to indeed control the ubiquitination of regulatory short-lived proteins[1], such as transactivator Gcn4<sup><a href="#re3">[3]</a></sup> and G1 cyclins in yeast and mammalian cells. Phosphorylation of particular Ser or Thr residues in the PEST regions of these G1 cyclins specifies their recognition and processing by the ubiquitin-proteasome pathway. | + | The covalent linkage of ubiquitin to lysine residues of substrate proteins is a common means used by eucaryotic cells to signal their degradation by the 26S proteasome, a multiprotease complex located in the cytoplasm and the nucleus<sup><a href="#re2">[2]</a></sup>. Decades ago it had been demonstrated that the PEST regions, enriched with Pro, Glu, Ser, and Thr, were identified to indeed control the ubiquitination of regulatory short-lived proteins<sup><a href="#re1">[1]</a></sup> |
| + | , such as transactivator Gcn4<sup><a href="#re3">[3]</a></sup> and G1 cyclins in yeast and mammalian cells. Phosphorylation of particular Ser or Thr residues in the PEST regions of these G1 cyclins specifies their recognition and processing by the ubiquitin-proteasome pathway. | ||
</p> | </p> | ||
</div> | </div> | ||
| Line 178: | Line 174: | ||
<p> | <p> | ||
Sequence: <br> | Sequence: <br> | ||
| − | + | AACTCTCACGGTTTCCCACCAGAAGTTGAAGAACAAGCTGCTGGTACTTTGCCAATGTCTTGTGCTCAAGAATCTGG<br>TATGGACAGACACCCAGCTGCTTGTGCTTCTGCTAGAATCAACGTT<br> | |
Features: shortener NanoLuc lifetime contributes to the higher sensitivity | Features: shortener NanoLuc lifetime contributes to the higher sensitivity | ||
</p> | </p> | ||
| Line 204: | Line 200: | ||
<div class="col-xs-12 text"> | <div class="col-xs-12 text"> | ||
<p> | <p> | ||
| − | We compare the degradation of the origin with improved NanoLuc | + | We compare the degradation of the origin with improved NanoLuc in 3 hours. |
</p> | </p> | ||
</div> | </div> | ||
| − | + | ||
| − | + | ||
| − | + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/e/e0/T--Tianjin--NanoLuchPEST.jpg" height="400"></div> | |
| + | |||
| + | |||
| + | |||
<div class="col-xs-12 text"> | <div class="col-xs-12 text"> | ||
<p> | <p> | ||
| − | You can download the protocol <a href="2018.igem.org"> | + | You can download the protocol from the <a href="https://2018.igem.org/Team:Tianjin/Notebook">notebook</a>.<br> |
In this case, we have proved the newly constructed NanoLucPEST could work effectively in <em>Saccharomyces cerevisiae</em> BY4741. The sensitive reporter can be used in ample types of yeast after appropriate codon-optimization<sup><a href="#re5">[5]</a></sup> | In this case, we have proved the newly constructed NanoLucPEST could work effectively in <em>Saccharomyces cerevisiae</em> BY4741. The sensitive reporter can be used in ample types of yeast after appropriate codon-optimization<sup><a href="#re5">[5]</a></sup> | ||
</p> | </p> | ||
| Line 247: | Line 246: | ||
</div> | </div> | ||
</div> | </div> | ||
| + | </div> | ||
<div id="footer" style="background-color: #79acdd;text-align: center;"> | <div id="footer" style="background-color: #79acdd;text-align: center;"> | ||
Latest revision as of 13:03, 6 December 2018
<!DOCTYPE html>
We improved a new part (BBa_K2637010) from the wide-used luciferase, NanoLuc (BBa_K1680009) to speed up its degradation and increase the sensitivity.
Description
Inspired by our time-course measurement for the KaiABC oscillatory system, we realized the importance of the sensitivity of reporter genes when used to characterize the variation in our engineering strains.
With the knowledge that the instability of proteins is associated with the existence of the so-called PEST regions, which control the ubiquitination of regulatory short-lived proteins[1], we decided to optimize our NanoLuc with the potentially degrading sequence PSET to shorten its intracellular lifetime.
Function of PEST
The covalent linkage of ubiquitin to lysine residues of substrate proteins is a common means used by eucaryotic cells to signal their degradation by the 26S proteasome, a multiprotease complex located in the cytoplasm and the nucleus[2]. Decades ago it had been demonstrated that the PEST regions, enriched with Pro, Glu, Ser, and Thr, were identified to indeed control the ubiquitination of regulatory short-lived proteins[1] , such as transactivator Gcn4[3] and G1 cyclins in yeast and mammalian cells. Phosphorylation of particular Ser or Thr residues in the PEST regions of these G1 cyclins specifies their recognition and processing by the ubiquitin-proteasome pathway.
Sequence and features
Sequence:
AACTCTCACGGTTTCCCACCAGAAGTTGAAGAACAAGCTGCTGGTACTTTGCCAATGTCTTGTGCTCAAGAATCTGG
TATGGACAGACACCCAGCTGCTTGTGCTTCTGCTAGAATCAACGTT
Features: shortener NanoLuc lifetime contributes to the higher sensitivity
Origin（Organism）
Sequence:
PEST sequence can be found in variety of eukaryotic cells and the sequence we used was from the literature Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate[4].
Experimental characterization
We compare the degradation of the origin with improved NanoLuc in 3 hours.
