Difference between revisions of "Team:Tianjin/Improve"

(Prototype team page)
 
 
(25 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
{{Tianjin}}
 
{{Tianjin}}
 +
<!DOCTYPE html>
 
<html>
 
<html>
 +
<head>
 +
<script src="https://2018.igem.org/Team:Tianjin/js/jquery?action=raw&ctype=text/javascript"></script>
 +
        <meta charset="utf-8">
 +
        <meta http-equiv="X-UA-Compatible" content="IE=Edge,chrome=1"/>
 +
        <meta content="width=device-width,initial-scale=1.0,maximum-scale=1.0,user-scalable=0;" name="viewport">
 +
        <meta name="renderer" content="webkit">
 +
        <meta name="author" content="773715181 Jiaxiao Han">
 +
        <meta content="2018iGEM Team:Tianjin Kai System to control biological clock" name="description">
 +
        <meta content="Team:Tianjin,iGEM:Tianjin,iGEM,2018iGEM" name="keywords">
 +
        <meta content="biological clock,clock,Kai,Kai A,Kai B,KaiC" name="keywords">
 +
<title>Team:Tianjin - 2018.igem.org</title>
 +
        <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/bootstrap?action=raw&ctype=text/css">
 +
        <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/base?action=raw&ctype=text/css">
 +
        <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/font-awesome?action=raw&ctype=text/css">
 +
        <link rel="stylesheet" type="text/css" href="https://2018.igem.org/Team:Tianjin/css/text?action=raw&ctype=text/css">
 +
        <script src="https://2018.igem.org/Team:Tianjin/js/bootstrap?action=raw&ctype=text/javascript"></script>
 +
        <style>a:visited{    color: #337ab7;}</style>
 +
</head>
 +
<!-- delete.css  -->
 +
<style>
 +
#globalWrapper,#content{background-color:transparent;border:0;border-bottom:0;float:none;margin:0;padding:0;width:100%;list-style-image:none}#top_title{margin:0}#HQ_page th{background-color:transparent;padding:0;color:black;border:0;border-collapse:collapse;vertical-align:text-top;text-transform:uppercase;text-align:center}#HQ_page td{padding:0;border:0;vertical-align:text-top;text-align:center;line-height:35px}#HQ_page .jumbotron p{text-align:center;margin-bottom:15px;font-weight:200}#HQ_page p{text-align:center}body{margin-bottom:-10px}#top_title,#sideMenu{display:none}a:hover{text-decoration:none}.mw-content-ltr ul{padding-top:0;padding-right:0;margin:auto}body{margin-top:0}#wrapper{padding-left:0}#page-wrapper{width:100%;padding:0}.intro{background-size:cover;width:100%;position:relative}.huge{font-size:50px;line-height:normal}
 +
</style>
  
 +
<style>
 +
#top_title{display:none;}
 +
.igem_2018_team_menu{display:none !important;}
 +
</style>
  
−
<div class="column full_size judges-will-not-evaluate">
+
<script>
−
<h3>★  ALERT! </h3>
+
$('#top_title').remove();$("#globalWrapper").removeAttr("id");$("#content").removeAttr("id");$("#HQ_page").removeAttr("id");$('.mw-body').removeClass('mw-body');$('.igem_2018_team_mobile_bar').remove();
−
<p>This page is used by the judges to evaluate your team for the <a href="https://2018.igem.org/Judging/Medals">medal criterion</a> or <a href="https://2018.igem.org/Judging/Awards"> award listed below</a>. </p>
+
$('#bodyContent').removeAttr("id");
−
<p> Delete this box in order to be evaluated for this medal criterion and/or award. See more information at <a href="https://2018.igem.org/Judging/Pages_for_Awards"> Instructions for Pages for awards</a>.</p>
+
$('#mw-content-text').removeAttr("id");
−
</div>
+
$('.mw-content-ltr').removeAttr("class");
 +
$('.igem_2018_team_menu displaying_menu').remove();
 +
$('.igem_2018_team_content').removeAttr("class");
 +
$('.igem_2018_team_column_wrapper').removeAttr("class");
 +
$('.igem_2018_team_menu').remove();
 +
</script>
 +
</head>
 +
<body>
 +
    <nav class="navbar navbar-default navbar-fixed-top" role="navigation" style="background-color:#79acdd;margin-top:14px;">
 +
    <div class="container-fluid">
 +
        <button type="button" class="navbar-toggle collapsed" data-toggle="collapse" data-target=".navbar-main-collapse">
 +
            <i class="fa fa-bars"></i>
 +
        </button>
 +
    <div class="navbar-header">
 +
        <div class="navbar-brand" href="https://2018.igem.org/Team:Tianjin">
 +
            <a href="https://2018.igem.org/Team:Tianjin">
 +
            <div class="circle" style="background-image:url(https://static.igem.org/mediawiki/2018/4/45/T--Tianjin--logo.png);left: 50px;">
 +
            </div>
 +
            </a>
 +
        </div>
 +
    </div>
 +
        <div class="navbar-collapse navbar-right navbar-main-collapse collapse">
 +
        <ul class="nav navbar-nav navbar-right" style="margin: 15px;">
 +
            <li class="dropdown">
 +
                <a href="#" class="dropdown-toggle" data-toggle="dropdown">
 +
                    PROJECT
 +
                    <b class="caret"></b>
 +
                </a>
 +
                <ul class="dropdown-menu" style="left: -14px;">
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Description">BACKGROUND</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Design">DESIGN</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Experiments">EXPERIMENTS</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Notebook">NOTEBOOK</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Model">MODEL</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Measurement">MEASUREMENT</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Demonstrate">DEMONSTRATE</a></li>
 +
                </ul>
 +
            </li>
 +
            <li class="dropdown">
 +
                <a href="#" class="dropdown-toggle" data-toggle="dropdown">
 +
                    PARTS
 +
                    <b class="caret"></b>
 +
                </a>
 +
                <ul class="dropdown-menu" style="left: -26px;">
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Parts">PARTS OVERVIEW</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Basic_Part">BASIC PARTS</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Composite_Part">COMPOSITE PARTS</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Part_Collection">PART COLLECTION</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Improve">IMPROVED PART</a></li>
 +
                </ul>
 +
            </li>
 +
            <li>
 +
                <a href="https://2018.igem.org/Team:Tianjin/Safety">
 +
                    SAFETY             
 +
                </a>
 +
            </li>
 +
            <li class="dropdown">
 +
                <a href="#" class="dropdown-toggle" data-toggle="dropdown">
 +
                    HUMAN PRACTICES
 +
                    <b class="caret"></b>
 +
                </a>
 +
                <ul class="dropdown-menu">
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Human_Practices">INTEGRATED</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Collaborations">COLLABORATION</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Public_Engagement">PUBLIC ENGAGEMENT</a></li>
 +
                </ul>
 +
            </li>
 +
            <li class="dropdown">
 +
                <a href="#" class="dropdown-toggle" data-toggle="dropdown">
 +
                    TEAM
 +
                    <b class="caret"></b>
 +
                </a>
 +
                <ul class="dropdown-menu" style="left: -29px;">
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Team">MEMBERS</a></li>
 +
                    <li><a href="https://2018.igem.org/Team:Tianjin/Attributions">ATTRIBUTIONS</a></li>
 +
                </ul>
 +
            </li>
 +
            <li>
 +
                <a href="https://2018.igem.org/Team:Tianjin/Judging">
 +
                  FOR JUDGES             
 +
                </a>
 +
            </li>
 +
        </ul>
 +
    </div>
 +
    </div>
 +
    </nav>
 +
    <script type="text/javascript" src="https://2018.igem.org/Team:Tianjin/js/navigation?action=raw&ctype=text/javascript"></script>
  
 +
    <div id="fill" style="width: 100%;margin-top:-14px;"></div>
  
−
<div class="clear"></div>
+
    <div id="MainPic">
 +
        <div id="bannercontent">
 +
            <div id="BgChange">
 +
                <img src="https://static.igem.org/mediawiki/2018/1/14/T--Tianjin--improved.png" style="width: 100%;">
 +
            </div>
 +
        </div>
 +
    </div>
 +
    <div class="container ">
 +
        <div class="row">
 +
          <div class="row partition"></div>
 +
        <div class="row">
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    We improved a new part (<a href="http://parts.igem.org/Part:BBa_K2637010">BBa_K2637010</a>) from the wide-used luciferase, NanoLuc (<a href="http://parts.igem.org/Part:BBa_K1680009">BBa_K1680009</a>) to speed up its degradation and increase the sensitivity.
 +
                </p>
 +
            </div>
 +
            <div class="col-xs-12 ">
 +
                <div class="title title-normal">
 +
                    <p>Description</p>
 +
                </div>
 +
            </div>
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    Inspired by our time-course measurement for the KaiABC oscillatory system, we realized the importance of the sensitivity of reporter genes when used to characterize the variation in our engineering strains.<br>
 +
                    With the knowledge that the instability of proteins is associated with the existence of the so-called PEST regions, which control the ubiquitination of regulatory short-lived proteins<sup><a href="#re1">[1]</a></sup>, we decided to optimize our NanoLuc with the potentially degrading sequence PSET to shorten its intracellular lifetime.
 +
                </p>
 +
            </div>
 +
        </div>
 +
        <div class="row">
 +
            <div class="col-xs-12 ">
 +
                <div class="title title-normal">
 +
                    <p>Function of PEST</p>
 +
                </div>
 +
            </div>
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    The covalent linkage of ubiquitin to lysine residues of substrate proteins is a common means used by eucaryotic cells to signal their degradation by the 26S proteasome, a multiprotease complex located in the cytoplasm and the nucleus<sup><a href="#re2">[2]</a></sup>. Decades ago it had been demonstrated that the PEST regions, enriched with Pro, Glu, Ser, and Thr, were identified to indeed control the ubiquitination of regulatory short-lived proteins<sup><a href="#re1">[1]</a></sup>
 +
, such as transactivator Gcn4<sup><a href="#re3">[3]</a></sup> and G1 cyclins in yeast and mammalian cells. Phosphorylation of particular Ser or Thr residues in the PEST regions of these G1 cyclins specifies their recognition and processing by the ubiquitin-proteasome pathway.
 +
                </p>
 +
            </div>
 +
        </div>
 +
        <div class="row">
 +
            <div class="col-xs-12 ">
 +
                <div class="title title-normal">
 +
                    <p>Sequence and features</p>
 +
                </div>
 +
            </div>
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    Sequence: <br>
 +
                    AACTCTCACGGTTTCCCACCAGAAGTTGAAGAACAAGCTGCTGGTACTTTGCCAATGTCTTGTGCTCAAGAATCTGG<br>TATGGACAGACACCCAGCTGCTTGTGCTTCTGCTAGAATCAACGTT<br>
 +
                    Features: shortener NanoLuc lifetime contributes to the higher sensitivity
 +
                </p>
 +
            </div>
 +
        </div>
 +
        <div class="row">
 +
            <div class="col-xs-12 ">
 +
                <div class="title title-normal">
 +
                    <p>Origin（Organism）</p>
 +
                </div>
 +
            </div>
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    Sequence: <br>
 +
                    PEST sequence can be found in variety of eukaryotic cells and the sequence we used was from the literature Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate<sup><a href="#re4">[4]</a></sup>.
 +
                </p>
 +
            </div>
 +
        </div>
 +
        <div class="row">
 +
            <div class="col-xs-12 ">
 +
                <div class="title title-normal">
 +
                    <p>Experimental characterization</p>
 +
                </div>
 +
            </div>
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    We compare the degradation of the origin with improved NanoLuc in 3 hours.
 +
                </p>
 +
            </div>
  
  
−
<div class="column full_size">
+
<div align="center"><img src="https://static.igem.org/mediawiki/2018/e/e0/T--Tianjin--NanoLuchPEST.jpg" height="400"></div>  
−
<h1>Improve</h1>
+
−
<p>For teams seeking to improve upon a previous part or project, you should document all of your work on this page. Please remember to include all part measurement and characterization data on the part page on the Registry. Please include a link to your improved part on this page.</p>
+
  
−
<h3>Gold Medal Criterion #2</h3>
 
−
<p><b>Standard Tracks:</b> Create a new part that has a functional improvement upon an existing BioBrick part. The sequences of the new and existing parts must be different. You must perform experiments with both parts to demonstrate this improvement.  Document the experimental characterization on the Part's Main Page on the Registry for both the existing and new parts. Both the new and existing Main Page of each Part’s Registry entry must reference each other. Submit a sample of the new part to the Registry.
 
  
−
The existing part must NOT be from your 2018 part number range and must be different from the part documented in bronze #4.
 
−
 
−
<br><br>
 
−
<b>Special Tracks:</b> Improve the function of an existing iGEM project (that your current team did not originally create) and display your achievement on your wiki.</p>
 
  
 +
            <div class="col-xs-12 text">
 +
                <p>
 +
                    You can download the protocol from the <a href="https://2018.igem.org/Team:Tianjin/Notebook">notebook</a>.<br>
 +
                    In this case, we have proved the newly constructed NanoLucPEST could work effectively in <em>Saccharomyces cerevisiae</em> BY4741. The sensitive reporter can be used in ample types of yeast after appropriate codon-optimization<sup><a href="#re5">[5]</a></sup>
 +
                </p>
 +
            </div>
 +
        </div>
  
 +
       
 +
        <div class="row">
 +
            <div>
 +
                <div class="reference">
 +
                    <h1>References</h1>
 +
                    <p class="reftext" id="re1">
 +
                        <a>[1]Rogers, S., R. Wells, and M. Rechsteiner. 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 234:364–368.</a>
 +
                        <br>
 +
                    </p>
 +
                    <p class="reftext" id="re2">
 +
                        <a>[2]5. Ciechanover, A. 1994. The ubiquitin-proteasome proteolytic pathway. Cell 79:13–21.</a>
 +
                        <br>
 +
                    </p>
 +
                    <p class="reftext" id="re3">
 +
                        <a>[3] Kornitzer, D., B. Raboy, R. G. Kulka, and G. R. Fink. 1994. Regulated degradation of the transcription factor Gcn4. EMBO J. 13:6021–6030.</a>
 +
                        <br>
 +
                    </p>
 +
                    <p class="reftext" id="re4">
 +
                        <a>[4]Hall MP, Unch J, Binkowski BF, et al. 2012. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol 7: 1848–1857.</a>
 +
                        <br>
 +
                    </p>
 +
                    <p class="reftext" id="re5">
 +
                        <a>[5]Anna E. Masser, Ganapathi Kandasamy, Jayasankar Mohanakrishnan Kaimal and Claes Andréasson.Luciferase NanoLuc as a reporter for gene expression and protein levels in Saccharomyces cerevisiae.YEAST 2016. DOI: 10.1002/yea.3155</a>
 +
                        <br>
 +
                    </p>
 +
                </div>   
 +
            </div>
 +
        </div>
 +
    </div>
 
</div>
 
</div>
  
−
 
+
    <div id="footer" style="background-color: #79acdd;text-align: center;">
−
 
+
        <div class="container">
 +
            <div class="row">
 +
                <div class="col-sm-3 footer-part">
 +
                    <p>
 +
                        <i class="fa fa-weixin fa-lg"></i>
 +
                        IGEMTIANJIN
 +
                    </p>
 +
                </div>
 +
                <div class="col-sm-3 footer-part">
 +
                    <p>
 +
                        <i class="fa fa-twitter fa-lg"></i>
 +
                        IGEMTIANJIN2018
 +
                    </p>
 +
                </div>
 +
                <div class="col-sm-3 footer-part">
 +
                    <p>
 +
                        <i class="fa fa-envelope fa-lg"></i>
 +
                        HEBO@TJU.EDU.CN
 +
                    </p>
 +
                </div>
 +
                <div class="col-sm-3 footer-part">
 +
                    <p>
 +
                        <i class="fa fa-institution fa-lg"></i>
 +
                        BEIYANG CAMPUS,TIANJIN UNIVERSITY,TIANJIN
 +
                    </p>
 +
                </div>
 +
            </div>
 +
        </div>
 +
    </div>
 +
<script type="text/javascript" src="https://2018.igem.org/Team:Tianjin/js/timeline?action=raw&ctype=text/javascript"></script>
 +
</body>
 
</html>
 
</html>

Latest revision as of 13:03, 6 December 2018

<!DOCTYPE html> Team:Tianjin - 2018.igem.org

We improved a new part (BBa_K2637010) from the wide-used luciferase, NanoLuc (BBa_K1680009) to speed up its degradation and increase the sensitivity.

Description

Inspired by our time-course measurement for the KaiABC oscillatory system, we realized the importance of the sensitivity of reporter genes when used to characterize the variation in our engineering strains.
With the knowledge that the instability of proteins is associated with the existence of the so-called PEST regions, which control the ubiquitination of regulatory short-lived proteins[1], we decided to optimize our NanoLuc with the potentially degrading sequence PSET to shorten its intracellular lifetime.

Function of PEST

The covalent linkage of ubiquitin to lysine residues of substrate proteins is a common means used by eucaryotic cells to signal their degradation by the 26S proteasome, a multiprotease complex located in the cytoplasm and the nucleus[2]. Decades ago it had been demonstrated that the PEST regions, enriched with Pro, Glu, Ser, and Thr, were identified to indeed control the ubiquitination of regulatory short-lived proteins[1] , such as transactivator Gcn4[3] and G1 cyclins in yeast and mammalian cells. Phosphorylation of particular Ser or Thr residues in the PEST regions of these G1 cyclins specifies their recognition and processing by the ubiquitin-proteasome pathway.

Sequence and features

Sequence:
AACTCTCACGGTTTCCCACCAGAAGTTGAAGAACAAGCTGCTGGTACTTTGCCAATGTCTTGTGCTCAAGAATCTGG
TATGGACAGACACCCAGCTGCTTGTGCTTCTGCTAGAATCAACGTT
Features: shortener NanoLuc lifetime contributes to the higher sensitivity

Origin（Organism）

Sequence:
PEST sequence can be found in variety of eukaryotic cells and the sequence we used was from the literature Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate[4].

Experimental characterization

We compare the degradation of the origin with improved NanoLuc in 3 hours.

You can download the protocol from the notebook.
In this case, we have proved the newly constructed NanoLucPEST could work effectively in Saccharomyces cerevisiae BY4741. The sensitive reporter can be used in ample types of yeast after appropriate codon-optimization[5]

References

[1]Rogers, S., R. Wells, and M. Rechsteiner. 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 234:364–368.

[2]5. Ciechanover, A. 1994. The ubiquitin-proteasome proteolytic pathway. Cell 79:13–21.

[3] Kornitzer, D., B. Raboy, R. G. Kulka, and G. R. Fink. 1994. Regulated degradation of the transcription factor Gcn4. EMBO J. 13:6021–6030.

[4]Hall MP, Unch J, Binkowski BF, et al. 2012. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol 7: 1848–1857.

[5]Anna E. Masser, Ganapathi Kandasamy, Jayasankar Mohanakrishnan Kaimal and Claes Andréasson.Luciferase NanoLuc as a reporter for gene expression and protein levels in Saccharomyces cerevisiae.YEAST 2016. DOI: 10.1002/yea.3155