Difference between revisions of "Team:Tianjin/Improve"
| Line 203: | Line 203: | ||
| − | <div align="center"><img src="https://static.igem.org/mediawiki/2018/e/e0/T--Tianjin--NanoLuchPEST.jpg" height=" | + | <div align="center"><img src="https://static.igem.org/mediawiki/2018/e/e0/T--Tianjin--NanoLuchPEST.jpg" height="400"></div> |
| Line 209: | Line 209: | ||
<div class="col-xs-12 text"> | <div class="col-xs-12 text"> | ||
<p> | <p> | ||
| − | You can download the protocol <a href="2018.igem.org"> | + | You can download the protocol from the<a href="https://2018.igem.org/Team:Tianjin/Notebook">notebook</a>.<br> |
In this case, we have proved the newly constructed NanoLucPEST could work effectively in <em>Saccharomyces cerevisiae</em> BY4741. The sensitive reporter can be used in ample types of yeast after appropriate codon-optimization<sup><a href="#re5">[5]</a></sup> | In this case, we have proved the newly constructed NanoLucPEST could work effectively in <em>Saccharomyces cerevisiae</em> BY4741. The sensitive reporter can be used in ample types of yeast after appropriate codon-optimization<sup><a href="#re5">[5]</a></sup> | ||
</p> | </p> | ||
Revision as of 17:04, 16 October 2018
<!DOCTYPE html>
We improved a new part (BBa_K2637010) from the wide-used luciferase, NanoLuc (BBa_K1680009) to speed up its degradation and increase the sensitivity.
Description
Inspired by our time-course measurement for the KaiABC oscillatory system, we realized the importance of the sensitivity of reporter genes when used to characterize the variation in our engineering strains.
With the knowledge that the instability of proteins is associated with the existence of the so-called PEST regions, which control the ubiquitination of regulatory short-lived proteins[1], we decided to optimize our NanoLuc with the potentially degrading sequence PSET to shorten its intracellular lifetime.
Function of PEST
The covalent linkage of ubiquitin to lysine residues of substrate proteins is a common means used by eucaryotic cells to signal their degradation by the 26S proteasome, a multiprotease complex located in the cytoplasm and the nucleus[2]. Decades ago it had been demonstrated that the PEST regions, enriched with Pro, Glu, Ser, and Thr, were identified to indeed control the ubiquitination of regulatory short-lived proteins[1], such as transactivator Gcn4[3] and G1 cyclins in yeast and mammalian cells. Phosphorylation of particular Ser or Thr residues in the PEST regions of these G1 cyclins specifies their recognition and processing by the ubiquitin-proteasome pathway.
Sequence and features
Sequence:
AACTCTCACGGTTTCCCACCAGAAGTTGAAGAACAAGCTGCTGGTACTTTGCCAATGTCTTGTGCTCAAGAATCTGG
TATGGACAGACACCCAGCTGCTTGTGCTTCTGCTAGAATCAACGTT
Features: shortener NanoLuc lifetime contributes to the higher sensitivity
Origin（Organism）
Sequence:
PEST sequence can be found in variety of eukaryotic cells and the sequence we used was from the literature Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate[4].
Experimental characterization
We compare the degradation of the origin with improved NanoLuc in 3 hours.
