Light-controlled system

3.Experimental results

3.1.Detection of expression efficiency of primary light control system in different hosts

3.2.Detection of PCR results of PT7 promoter (insertion fragment) and deleting PJ23100 promoter (linearized carrier) by electrophoresis gel

3.3.Detection of de-template results by electrophoresis gel

3.4.The results of secondary light control system effect detection

Back

Test Crisper/Cas9 system

After two transforming and the transformed plates placed in 30℃ devices overnight, E.coli MG1655+ΔpanD grew, E.coil MG1655 wild type died.It showed Crisper/Cas9 system can work.

Our target:

GTCCTAGGTATAATACTAGTGGCAATGAAAGACGGTGAGCGTTTTAGAGCTAGAAATAGC

sequencing results :

sequencing results showed construction successfully.

Test pTargetF-cm

After final transforming and the transformed plates placed in 30℃ devices overnight. We selected the strain and culture it both in LB+kan+spec and LB+cm. And the strain grew in LB+kan+spec, while it died in LB+cm（Fig.1）.

Back

Back

Under light and dark conditions, the transformation efficiencies with pTargetF-panD were 1.185 and 1.295 folds of thoese with pTargetF-cm respectively, demonstrating that pTargetF-cm could guide Cas9 to the cm gene on the genome and resulted in the decrease of transformation efficiency. The result also reflect that the blue light provided cannot completely suppress the expression of CRISPR/Cas9. It is also remarkable that the transformation efficiency with pTargetF-cm under the dark condition was lower than that under the light condition, indicating that the CRISPR/Cas9 system showed stronger activity under dark condition, achieving the purpose of cutting a resistance gene with the light-controlled CRISPR/Cas9 system.

Back

▶First step

Aim

We’d like to achieve the following purposes:
1、Construct a part with repression system.
2、Maximize the repression effect.
3、Select a more suitable system through comparison.

Experimental details

●lacI-Plac

（1）Obtain Objective strain

For testing this device we used DH5alpha cells which contain the plasmid named pGLO-lacI. This plasmid contains the parts (BBa_K2556032) we want to test. The steps are as follow:
①pCAS was cultured in the test tube with liquid LB medium. After 12h, we extracted the plasmid DNA and measured the concentration.
②We prepared the insertion fragment and the linearized carrier（pGLO）by PCR. Then the PCR product was de-templated by DpnⅠ. Finally PCR product was purified by TaKaRa kit to prepare for ligation.
③Construction of plasmids named pGLO-lacI by One step cloning
④Transform the pGLO-lacI into E.coli DH5α by Heat Shock and 10-100μL plated on antibiotic selective media(AMP).
⑤Colony PCR and we selected ideal colonies, sequenced by company ,preserved the strain and began to test the effectiveness of the repression system.

Verify the function of repression of lacI

①Strain contained target plasmid was cultured in the test tubes with liquid minimal medium. Different conditions are set in each test tube and the conditions can be seen clearly from the chart below. (Parallel three groups)
②OD600 and GFP values of the bacterial culture were measured periodically with the automatic microplate reader. For green fluorescence, excitation and emission wavelengths were 395 and 509 nm.
③Draw charts using measured data to verify the function of repression of lacI

（3）Maximize the repression effect.

①Strain contained target plasmid was cultured in the test tubes with liquid minimal medium. And the concentration gradients of arabinose were set in these tubes(2×10-5M,4×10-5M,8×10-5M,1.6×10-4M,3.2×10-4M）.
②OD600 and GFP values of the bacterial culture were measured periodically with the automatic microplate reader. For green fluorescence, excitation and emission wavelengths were 395 and 509 nm.
③Draw charts using measured data to observe the trends of repression.

●cI-PR

The same as above.

●lacI-Plac

(1)Verify the function of repression of lacI
The time history plot of Relative Fluorescence Unit of the objective strain(The strain contains the plasmid named pGLO-lacI） under different conditions is shown in Fig.1

(2)Maximize the repression effect

The time history plot of Relative Fluorescence Unit of the objective strain(The strain contains the plasmid named pGLO-lacI） under different concentration of arabinose is shown in Fig.2

●cI-PR

The time history plot of Relative Fluorescence Unit of the objective strain(The strain contains the plasmid named pGLO-cI） under concentration of arabinose is shown in Fig.3

Conclusions and analysis

①We construct both two parts with repression function (lacI-Plac, cI-PR) successfully.
lacI-Plac: By adding arabinose to induce the expression of LacI protein, the Relative Fluorescence Unit of the objective strain is lower which illustrate the effect of repressor. And, when adding the IPTG, the Relative Fluorescence Unit of the objective strain is higher which also prove the expression of LacI protein.
cI-PR：By adding arabinose to induce the expression of cI protein, the Relative Fluorescence Unit of the objective strain is lower which illustrate the effect of repressor.
②We gain two time history plots which are shown in Fig.2 and Fig.3 respectively.
lacI-Plac: When the concentration of arabinose is 2×10-5M and 8×10-5M,the repression effect of LacI repressor is relatively close. Compared with these concentration, repression effect of LacI repressor increases after 30h under the concentration of arabinose is 16×10-5M and decreases before 40h under the concentration of arabinose is 4×10-5M .
cI-PR：Only when the concentration of arabinose is 2×10-5M, this part could inhibit the transcription of downstream.
②We select lacI-Plac as our final repression system. Because lacI-Plac can maintain the stable effect of repression at different concentrations but cI-PR didn’t show that.

▶Second step

Aim

We aim to use the lacI repression system to regular the transcription of sgRNA which is designed to specifically bind to the gene panD on the E. coli genome.

Experimental details

●lacI-Plac-sgRNA

We constructed two compatible plasmids containing the sgRNA-regulated transcriptional system (BBa_K2556042) and the cas9 protein, respectively. And then we introduced two plasmids into E.coli MG1655. After obtaining the transformants, we tried to demonstrate the difference of the transcriptional level of sgRNA by analyzing the growth curves in four different conditions (①+2×10-5M Ara +2×10-5M IPTG ②+2×10-5M Ara ③+2×10-5M IPTG ④None) . If sgRNA transcribe correctly, the CRISPR/Cas9 system will be activated. That means the target gene panD will be cut and the E. coli couldn’t survive.

Results

●lacI-Plac-sgRNA

We did three sets of parallel experiments and the result is shown in Fig.4.

Conclusions and analysis

Analysis of the experimental results revealed that the lacI repression system couldn’t regulate the transcription of sgRNA successfully, because the four growth curves in different conditions are very similar. We suspect the lac operator which directly links to the sgRNA affects its conformation so that the sgRNA can’t be unable to function properly.

After consulting the literatures, we demonstrate it was exactly a DNA sequence before the sgRNA that prevented it from maturation. And it also doesn’t work if we add a repeat artificially before sgRNA. Because it has been published that tracrRNA directs the maturation of crRNAs by the activities of the widely conserved endogenous RNase III and the CRISPR-associated Csn1 protein. This limits the use of the CRISPR/Cas9 system in E.coli.

Here we present two solutions. First, try to find a suitable repression system to replace the lacI repression system, which means sgRNA should be linked directly to the transcription initiation site (TSS). Second, activate the type I CRISPR/Cas system in E.coli because of the less limitation in comparison with the type II CRISPR/Cas system.

Back

Back