Team:Manchester/Rokiskiosuris
CHEESEMAKER FROM ROKIŠKIO SŪRIS
Our project is designed to make cheese products safer. If applied, this idea would influence current cheesemakers. As we would like cheese makers to consider our innovation, first we need to examine their suggestions because they are experts in making cheese and so can provide valuable advice on our project design.
We arranged a phone call with Vadimas Kličius, the Director of New Product Development at “Rokiškio sūris” (a major cheese manufacturer in Lithuania) to discuss our project idea.
The take-home message from the talk was that mesophilic L. lactis bacteria culture may not be an optimal choice for the biosensor. This bacteria culture could not be used in making hard cheeses. Additionally, some of the soft cheeses that we were targeting with our project do not use L.lactis in the manufacturing process. To improve our project design, we have optimised codon sequences for a thermophilic bacteria Streptococcus thermophilus.
Vadimas also mentioned that GMOs in cheese are not acceptable and that would be the main issue in applying our biosensor in any cheese making company. This inspired our discussions with the European Commission about current GMO regulations and their impact on our project
To get a real-world cheese maker's perspective on the industrial constraints affecting our project we spoke to Vadimas Kličius, who is the Director of New Product Development in “Rokiškio sūris”, a major cheese manufacturer in Lithuania. Mr. Kličius introduced us to the safety measures employed in the company to keep products safe. To ensure safety, samples are taken during different stages of the cheese making process. Since tests for pathogenic bacteria (e.g. Listeria or Salmonella) cannot be run in the cheese making factory (because tests require growing potentially pathogenic cultures, which are forbidden for safety reasons), all samples are sent to external microbiology labs for analysis. It takes around 1 to 3 weeks to get the results back. Most interesting for the assessment of the economic feasibility of our alternative testing device was information on the price of this off-site testing of cheese samples.
Current tests involve the following costs (prices at the National Food and Veterinary Risk Assessment Institute of Lithuania):
We learned from Mr. Kličius that L. lactis, the bacterial species we are targeting in our iGEM project, is not necessarily used to make soft cheeses (e.g. mozzarella). The species is instead mostly used for making semi-hard cheeses, which are currently not the target of our detector device. Though we did not have time to work with an alternative lactic acid bacteria, we codon optimised the DNA sequences of the agr operon for expression in the chassis organism he recommended, Streptococcus thermophilus (Figure 1).
agrB
ATGCATCATCATCATCATCATGGTTCAGGTGGTTCAAATTTTACAGCTAAAGTTCCACTTTCAGAACGTATGGCTGATGTTCTTATTTCAAAAGATCGTTGGAAAGATGATGAAGAAGGTTATCTTAAAGTTAAATATGGTCTTGAAATTATTCTTATTAATGTTATGAAATTTGCTCTTGTTTATGGTATTGCTCTTGTTACAGGTCTTCTTCTTCAAACAGTTACAGTTCATCTTTCATATCTTTGGCTTCGTCGTTATTCATTTGGTCTTCATGCTACAAAAACACTTAATTGTACACTTATTTCACTTCTTATGTTTGTTCTTGCTCCATTTGTTTTTCAAAATATTCCATCAAATAATTGGATTGTTCTTGGTACATTTGGTTTTATTCTTCTTAATATGTTTCTTTTTGCTCCAGCTGATACAGAATCACTTCCACTTATTGGTGAAGAACATCGTAAAACACTTAAACGTAAAGCTATGATTGGTACACTTATTCTTACAGGTATTGCTCTTCTTATTCCATTTGCTGAAATGAAAACACTTATTATGGTTGGTTCACTTTTTCAAGTTATTTCAATTAATCCACTTACATATAAACTTCTTAAACGTCGTTATCGTAATTATGAAAAATATGAATAA
agrC
ATGTTTTCAATTCTTATGGCTATTATTCAAATTACAGGTATTTTTATTGCTATTCAAATTCTTACAAATAAAGTTTTTTCAATTAAAGAAGGTCTTGTTACAATTGCTATTGCTATGCTTGCTTTTCCACTTTTTACACTTGTTCAATATTGGTCAATGATTTTTGTTCTTATTGTTTTTGTTTCAGCTCTTTATTGGAAAAATAAAAATGTTGTTGTTTCAGCTTCAATTACACTTGTTGTTATTATTCTTCTTACAATTTCAGATTCAATTGTTGGTTTTATTCTTGTTCCAGGTCTTAATTTTAAATATGATGAAATTTTTAATGAACTTCTTCCAACACTTATTTATTGTGCTGGTATGCTTGCTAATCTTCTTGTTTTTTCATTTCTTCTTCGTAAACTTATTGAAAAAGTTAATATTTCACGTTTTGTTGAACATCGTAAATATGCTTATATTATTTTTTCAATTGTTGCTCTTACAGTTCTTGCTTTTTATATGAATATTTATGCTGGTTCAATTGCTGGTTTTGATGGTTCAGTTCTTAAAATTAATACACTTATTTTTACAGGTTATACAATTCTTCTTATTGTTATTGTTACAGTTGTTATTAATACAGCTACAAATGAACTTAAAGTTCAAAATCAAAAAGAACAACTTGAACAACTTCAAGATTATGTTACAACACTTGAATCACTTCATCGTGAAATGCGTGTTTTTCGTCATGATTATGTTAATATTCTTTCAACACTTGTTGGTTATATTGATAATAATGATATGCCAGGTCTTAAATATTATTTTGAAAATAATATTGTTCCAATTAATAAAACAATTGAATCAAATAATTATAAAATTTCACTTCTTCAAAATATTCATGTTATTGAACTTAAAGGTCTTCTTGCTGTTAAACTTATTCGTGCTCAAGAACTTAAAATTGATGCTATTCTTGAAGTTGTTGAACCAATTGATAAAATTTCAATGGATTCAATTGATCTTTGTAAAGTTGTTGGTATTCTTCTTGATAATGCTGTTGAAGCTGCTCTTACATGTGAAAATCCAGTTATTCGTATTGCTTTTGTTAAAAAAGGTGATTCAATTATTATTGTTTTTGCTAATTCACTTCCAGTTAATATGCCACCAATTTATAAAATTTTTGAAGAAGGTTTTTCAACAAAAGGTGAAGGTCGTGGTCTTGGTCTTGCTTCACTTCGTGAAATTATGAAAAAATATTCACATGTTGCTCTTGATACAAAAGTTACAGATCGTGAAGTTATTCAAGAACTTGAAATTATGGGTTCAGGTGGTCATCATCATCATCATCATTAATATTAA
agrA
ATGCTTCCAGTTTTTATTTGTGAAGATAATCGTATGCAACGTGAACGTCTTACAAAATATATTGAAGATTATATTATGGTTGAACATTTTGATATGAAACTTGAACTTTCAACAGGTGATCCATTTGAACTTGTTTCACGTATGCCAACACATCAAGGTATGGGTCTTTATTTTCTTGATATTGATCTTGGTCAACCAGATATGAATGGTTTTGAACTTGCTCAAGAAATTCGTAAATTTGATCCACGTGGTTTTATTATTTTTATTACAACACATGCTGAACTTTCATATATGACATTTACATATAAAGTTGAAGCTCTTGATTATATTATTAAAGATGATATTGATCTTCTTCATGATCGTGTTCTTGCTTGTATGAAACAAGCTGAAGAACGTATTTCAAATGATCAAGATATGCAAAAATATTTTACATTTAAAGTTTCAGATAAAAAAATTATTCATGAACTTCTTGATGATATTCTTTTTTTTGAAACAGCTCCAACAATTCATAAAGTTATTCTTCATGGTAAAAATCGTCAAGTTGAATTTTATGGTAAACTTAAAAATATTGAAAAAATGCTTGATGAATCATTTTATCGTTGTCATCGTTCATATATTGTTAATAAAAAAAATATTCATGAACTTGATACAACAAAAGGTGTTGTTAAAATGTCAAATGGTGAAAATTGTTATGCTTCATCAAAACTTATTAAATCACTTTCACTTCATCATCATCATCATCATTAA
Figure 1: Codon optimised sequences for agrB, agrA, and agrC. Top = codon optimised for expression in E. coli; Bottom = codon optimised for expression in S. thermophilus.
According to Mr. Kličius, modified L.lactis for Listeria detection could theoretically also be integrated into the soft-cheese starter cultures without negative effects on product quality.
We learned that the choice of a mesophilic bacterium L. lactis might not be optimal for industrial applications of our system. Firstly, some soft cheeses (e.g. mozzarella) have a formation step where the pre-cheese mass is heated up to 59-62°C and cheese is formed. Also, the process of making the majority of hard cheeses includes a stage where cheese granules are heated up to 38-58°C to dry them and control the fermentation process. A sensor system based on L. lactis bacteria would probably lose its function or even would not survive in such temperatures. Secondly, to make mature cheeses, they are kept at 9-12°C to keep the fermentation process slow. If L. lactis bacteria are added, the maturation rate would increase because such temperature is optimal for our mesophilic bacteria to grow. As a result, cheese quality and flavour might change.
When asked about the potential of our Man-Cheester project, Mr. Kličius responded that the idea is promising, but that currently no one would buy a GMO-containing cheese. He even mentioned that big companies which are buying products from “Rokiškio sūris” ask for tests which prove that products do not contain GMOs. This confirmed our earlier insights talking to artisan cheese makers, who expressed similar concerns (read more). Thus, although interaction with potential customers indicated that they might be much more open to GMO for cheese safety testing, the commercial viability of our device would depend on a change in risk perception among cheese producers and sellers, as well as changes in the regulation of GMOs in food. As a result, we had intense discussions with the European Commission regulating relevant GMO policies (read more), but we also explored possible modifications to our device that would ensure that no live GMOs are contained in the final product - considering that GMO-derived ingredients, such as vegetarian rennet, are widely accepted in commercial cheese products.