Parts/Improve Part
Parts
BBa_K2544000 KcsA expressing path
BBa_K2544001 KcsA protein domain
BBa_K2544002 D-AlaRS protein domain
BBa_K2544003 D-AlaRS expressing path
BBa_K2544004 tRNA
BBa_K2544005 KcsA* protein domain
BBa_K2544006 improved part:GFP coding device switched on by IPTG
BBa_K2544007 Alr protein domain
BBa_K2544008 The path introduces D-Ala into expressing system
Improve Part
pcat controlled GFP
pcat promtor controlled GFP
Function
Pcat+RBS+GFP+T
The purpose of this biobrick is to produce as much green fluorescence as possible, and ensure a strong GFP expression in E.coli. This biobrick was made from 2 parts:
1. BBa_K081005
2. BBa_J04430
This biobrick is an improvement of the biobrick BBa_J04430 designed by iGEM2005.
![](/wiki/images/0/0c/T--NWU-China--part_1.jpg)
![](/wiki/images/e/e8/T--NWU-China--part_2.png)
To test the correct functioning of this biobrick, we have performed three different types of experiment:
1.DNA sequencing ensures its accuracy;
2.Determination of plasmid molecular weight by agarose gel electrophoresis;
3.Measured the OD value and the green fluorescence value by microplate reader.
1.DNA sequencing
(1)BBa_K081005 Part-only sequence (58bp)
Ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaa
(2)BBa_J04430 Part-only sequence (1083bp)
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaataatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
Because our part is synthesized by the company, it ensures the correctness of the sequence.
2.Agarose gel electrophoresis
We calculated the new part’s base number to 1141 bp. The figure1 is the result of agarose gel electrophoresis. We can make a preliminary judgment that the sequences are correct.
![](https://static.igem.org/mediawiki/2018/d/d8/T--NWU-China--part2.jpg)
The result of agarose gel electrophoresis.
3.The OD value and the fluorescence value
We did a shaking test on the bacteria of the improvement part and the control group, and all the conditions were the same.Because of the time constraint, we did not measure the OD and fluorescence values of the improvement part and the control group.Eight hours after shaking the bacteria, we can visualize that our improvement part is higher than the control group.
![](https://static.igem.org/mediawiki/2018/2/2d/T--NWU-China--part23.jpg)
Results of fluorescence value of two groups of bacteria liquid.